ID: 974874397

View in Genome Browser
Species Human (GRCh38)
Location 4:67685625-67685647
Sequence CCATTAGGTCCTACGTAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 8}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874397_974874404 -6 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874397_974874409 14 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874409 4:67685662-67685684 TGGGAGGTGTTTAGGTCATGAGG 0: 93
1: 1068
2: 3098
3: 6930
4: 9516
974874397_974874407 6 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874407 4:67685654-67685676 TTGCCTAGTGGGAGGTGTTTAGG 0: 1
1: 11
2: 257
3: 1271
4: 2097
974874397_974874410 15 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874410 4:67685663-67685685 GGGAGGTGTTTAGGTCATGAGGG 0: 51
1: 536
2: 1995
3: 4419
4: 7815
974874397_974874405 -5 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417
974874397_974874406 -2 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874397 Original CRISPR CCATTAGGTCCTACGTAACG GGG (reversed) Intronic
1079306087 11:19324009-19324031 CTATAAGGTCCTACATAACATGG - Intergenic
1137835267 16:51586128-51586150 CTATAACGTCCTACGTAACCTGG + Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
927788593 2:25992002-25992024 CCATTAGGTTCTCAGTAAAGGGG - Intergenic
966545112 3:181137842-181137864 CCATTAGATCCTATGTAGTGTGG + Intergenic
974874397 4:67685625-67685647 CCATTAGGTCCTACGTAACGGGG - Intronic
1018299902 6:162390140-162390162 TCATGAGATCCTACATAACGTGG + Intronic
1047724237 8:127670424-127670446 CCACCAGGCCCTACGTGACGTGG + Intergenic
1191586521 X:62833285-62833307 CCATTAGGTCCCACCTAATTGGG + Intergenic