ID: 974874399

View in Genome Browser
Species Human (GRCh38)
Location 4:67685626-67685648
Sequence CCCATTAGGTCCTACGTAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874399_974874404 -7 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874399_974874409 13 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874409 4:67685662-67685684 TGGGAGGTGTTTAGGTCATGAGG 0: 93
1: 1068
2: 3098
3: 6930
4: 9516
974874399_974874410 14 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874410 4:67685663-67685685 GGGAGGTGTTTAGGTCATGAGGG 0: 51
1: 536
2: 1995
3: 4419
4: 7815
974874399_974874406 -3 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266
974874399_974874407 5 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874407 4:67685654-67685676 TTGCCTAGTGGGAGGTGTTTAGG 0: 1
1: 11
2: 257
3: 1271
4: 2097
974874399_974874405 -6 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874399 Original CRISPR CCCATTAGGTCCTACGTAAC GGG (reversed) Intronic
913199320 1:116483437-116483459 CCCATTAACTCCTTCCTAACAGG + Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1126640962 15:50826506-50826528 CCCATTAGGTCGTCCATCACTGG + Intergenic
1131079553 15:89523277-89523299 CCCATTTGTTCCCACGTATCAGG + Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1156891883 18:42199489-42199511 CCAACTAGGTCCTATGCAACAGG + Intergenic
927788595 2:25992003-25992025 CCCATTAGGTTCTCAGTAAAGGG - Intergenic
1170315685 20:15039035-15039057 CCTATTAGGTCCTTTGTTACAGG - Intronic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
987451750 5:18093464-18093486 CCCATTAGATCCTTCCTAATAGG - Intergenic
998245339 5:140497087-140497109 CCCATTAGAACCTAAGTCACTGG - Exonic
1007679782 6:43626144-43626166 CCCCTCAGGCCCTAGGTAACTGG + Intronic
1014140782 6:117939626-117939648 CCCTTTAGGTCCTTTTTAACTGG - Intronic
1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG + Intergenic