ID: 974874401

View in Genome Browser
Species Human (GRCh38)
Location 4:67685627-67685649
Sequence TCCCATTAGGTCCTACGTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874401_974874410 13 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874410 4:67685663-67685685 GGGAGGTGTTTAGGTCATGAGGG 0: 51
1: 536
2: 1995
3: 4419
4: 7815
974874401_974874404 -8 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874401_974874406 -4 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266
974874401_974874407 4 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874407 4:67685654-67685676 TTGCCTAGTGGGAGGTGTTTAGG 0: 1
1: 11
2: 257
3: 1271
4: 2097
974874401_974874405 -7 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417
974874401_974874409 12 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874409 4:67685662-67685684 TGGGAGGTGTTTAGGTCATGAGG 0: 93
1: 1068
2: 3098
3: 6930
4: 9516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874401 Original CRISPR TCCCATTAGGTCCTACGTAA CGG (reversed) Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
906897672 1:49795360-49795382 TCCCATCAGGAACTAAGTAAAGG + Intronic
909703644 1:78554388-78554410 TCCCACTAGCTCCCAAGTAATGG + Intergenic
911516094 1:98870001-98870023 TCTGATGAGGTCCTACCTAAGGG + Intergenic
918099870 1:181364073-181364095 TCCCATTAGGGCCTTTGTAATGG + Intergenic
1082711778 11:56561354-56561376 TCCCACTGGGTCCTGCGTAATGG + Intergenic
1085004577 11:73074557-73074579 TCTCTTTATGTCCTACTTAAGGG - Intronic
1097344731 12:58478150-58478172 TCCCATTATGTTTTAGGTAAGGG - Intergenic
1110797100 13:79652320-79652342 TCCCCTTAGGGCCTGGGTAAAGG + Intergenic
1119550240 14:75504745-75504767 TCCCATTAGGCCCCACTTACTGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1127294405 15:57597004-57597026 TCTCACCAGGTCCTACGTAGAGG + Intronic
1132439357 15:101843171-101843193 TCACATTAGGGCATACATAAGGG + Intergenic
1138719075 16:59058270-59058292 TCCCATGAGGTCATAGGTACAGG - Intergenic
1139331596 16:66196598-66196620 TCCCATTAGGGCCTTCATACAGG + Intergenic
1149290992 17:55217412-55217434 TCCCAATGGGTCCTACATATTGG + Intergenic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
927788597 2:25992004-25992026 ACCCATTAGGTTCTCAGTAAAGG - Intergenic
934781002 2:96969692-96969714 TCCCATTAGATTGTACGTTAGGG - Intronic
937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG + Intergenic
938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG + Intronic
940556338 2:155233274-155233296 GCCCACTAGGTCCTAAGGAAAGG - Intergenic
946505935 2:220300838-220300860 TTGCATTAGGTCCTAGGGAAAGG + Intergenic
1173265363 20:41474368-41474390 TCCCATGATCTCCAACGTAAAGG - Intronic
1176942625 21:14942204-14942226 TCCCCTTAGGTACAACTTAATGG - Intergenic
1177262025 21:18742087-18742109 TCCCCTTAGGTCATAAATAAAGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
964158435 3:153615998-153616020 TCTCATTAGGTTTTACATAAAGG + Intergenic
971817996 4:31514584-31514606 TCCCATTAGGGCTCACTTAAAGG + Intergenic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
977169543 4:93743752-93743774 TCCCATTAGGCCCCACCTAATGG + Intronic
978468330 4:109033020-109033042 TCCCACCAGGTCCTCCATAAAGG + Intronic
986677881 5:10203046-10203068 TCACATTAGTTCCTTCTTAATGG + Intergenic
1003828905 6:9983923-9983945 TATCATTAGGTTCTAAGTAAAGG - Intronic
1005023469 6:21440029-21440051 TCTCATTAAGTCCTATGTTAAGG - Intergenic
1024052711 7:45638972-45638994 TCCCATGTGGTCCTACTTCATGG - Intronic
1034239027 7:149595535-149595557 TCCCATCAGGTACTGAGTAAGGG - Intergenic
1034248093 7:149664545-149664567 TCCCATCAGGTACTGAGTAAGGG + Intergenic
1035123456 7:156589482-156589504 TTCCATCAAGTCCTATGTAATGG - Intergenic
1038284832 8:26197495-26197517 TTCCATTAGGGCCCACCTAATGG + Intergenic
1186520662 X:10203917-10203939 TCCCATTATGTATTACATAATGG + Intronic
1186520665 X:10203919-10203941 TCCCATTATGTAATACATAATGG - Intronic
1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG + Intergenic
1194703762 X:97148989-97149011 TCCCATTAGGTCCTATGACTTGG - Intronic
1197466829 X:126815085-126815107 TGCCATTAGCTCCTCAGTAATGG + Intergenic