ID: 974874403

View in Genome Browser
Species Human (GRCh38)
Location 4:67685640-67685662
Sequence ACTAGGCAACACCTCCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1182
Summary {0: 1, 1: 2, 2: 8, 3: 113, 4: 1058}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874403_974874407 -9 Left 974874403 4:67685640-67685662 CCTAATGGGAGGTGTTGCCTAGT 0: 1
1: 2
2: 8
3: 113
4: 1058
Right 974874407 4:67685654-67685676 TTGCCTAGTGGGAGGTGTTTAGG 0: 1
1: 11
2: 257
3: 1271
4: 2097
974874403_974874410 0 Left 974874403 4:67685640-67685662 CCTAATGGGAGGTGTTGCCTAGT 0: 1
1: 2
2: 8
3: 113
4: 1058
Right 974874410 4:67685663-67685685 GGGAGGTGTTTAGGTCATGAGGG 0: 51
1: 536
2: 1995
3: 4419
4: 7815
974874403_974874409 -1 Left 974874403 4:67685640-67685662 CCTAATGGGAGGTGTTGCCTAGT 0: 1
1: 2
2: 8
3: 113
4: 1058
Right 974874409 4:67685662-67685684 TGGGAGGTGTTTAGGTCATGAGG 0: 93
1: 1068
2: 3098
3: 6930
4: 9516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874403 Original CRISPR ACTAGGCAACACCTCCCATT AGG (reversed) Intronic
900039110 1:441940-441962 ACTGGGAGACACCTCCCAGTAGG + Intergenic
900060543 1:676916-676938 ACTGGGAGACACCTCCCAGTAGG + Intergenic
902965306 1:19996630-19996652 ACTGGGAGACACCTCCCAGTAGG + Intergenic
905525384 1:38634624-38634646 ACTGGGAGACACCTCCCAGTAGG - Intergenic
905897026 1:41554910-41554932 ACTGGGAGACACCTCCCAGTAGG - Intronic
905962911 1:42059962-42059984 ACTGGGAGACACCTCCCAGTAGG + Intergenic
906753698 1:48289078-48289100 ACTAGGAGGCACCTCCCAGTAGG + Intergenic
906834973 1:49073690-49073712 ACTGGGAGACACCTCCCAGTAGG - Intronic
906843012 1:49160489-49160511 ACTGGGAGACACCTCCCAGTAGG - Intronic
907005580 1:50910290-50910312 ACTGGGAGACACCTCCCAGTAGG - Intronic
907231734 1:53005354-53005376 ACTGGGAGACACCTCCCAGTAGG + Intronic
907978843 1:59460631-59460653 AATAGGAGACACCTCCCAGTAGG + Intronic
907994073 1:59611247-59611269 ACTGGGAGACACCTCCCAGTAGG + Intronic
908576665 1:65467451-65467473 ACTGGGAAACACCTTCCAGTAGG - Intronic
908595560 1:65685580-65685602 ACTGGGAGACACCTCCCAGTAGG - Intergenic
908821614 1:68093015-68093037 ACTGGGAGACACCTCCCAGTAGG - Intergenic
908937611 1:69394873-69394895 ACCAGGAGACACCTCCCAGTAGG - Intergenic
909273526 1:73654934-73654956 AATAGACTTCACCTCCCATTTGG + Intergenic
909403369 1:75258727-75258749 ACTGGGAGACACCTCCCAGTAGG + Intronic
909457049 1:75861684-75861706 ACTTGGAGACACCTCCCAGTAGG - Intronic
909558423 1:76981714-76981736 ACTGGGAGACACCTCCCAGTAGG + Intronic
909682724 1:78310746-78310768 ACTGGGAGACACCTCCCAGTAGG + Intronic
909707862 1:78608392-78608414 ACTGGGAAACATCTCCCAGTAGG + Intergenic
909807868 1:79894012-79894034 ACTTGGAGACACCTCCCAGTAGG - Intergenic
910383651 1:86658148-86658170 ACTGGGAGACACCTCCCAATAGG + Intergenic
910601155 1:89033998-89034020 ACTGGGAGACACCTCCCAGTAGG - Intergenic
910618782 1:89230204-89230226 ACTGGGAGACACCTCCCAGTAGG - Intergenic
910956918 1:92716189-92716211 ACTGGGAGACACCTCCCAGTAGG + Intronic
911079638 1:93916040-93916062 ACTGGGAGACACCTCCCAGTGGG - Intergenic
911217918 1:95216144-95216166 ACTGGGAGACACCTCCCAGTAGG - Intronic
911342133 1:96651958-96651980 ACTGGGAGACACCTCCCAGTAGG + Intergenic
911517140 1:98881019-98881041 ACTTGGAGACACCTCCCAGTAGG - Intergenic
911596069 1:99800306-99800328 ACTGGGAGACACCTCCCAGTAGG - Intergenic
911670614 1:100603677-100603699 ACTGGGAGACACCTCCCAGTAGG - Intergenic
911674821 1:100647267-100647289 ACTGGGCAGGACCTCCCAGTTGG + Intergenic
911700732 1:100949428-100949450 ACTGGGAGACACCTCCCAGTAGG - Intronic
911941939 1:104057763-104057785 ACTGGGCGACACCTCCCAGTAGG + Intergenic
911990709 1:104693585-104693607 ACTGGGAAAAACCTCCCAGTAGG + Intergenic
912463279 1:109851764-109851786 ACTGGGAGACACCTCCCAGTAGG + Intergenic
912646216 1:111394461-111394483 ACTGGGAGACACCTCCCAGTAGG + Intergenic
912742392 1:112212348-112212370 ACTGGGAGACACCTCCCAGTAGG + Intergenic
912886325 1:113478664-113478686 ACTGGGAGACACCTCCCAGTAGG - Intronic
912886507 1:113480307-113480329 ACTAGGCAAGCCCTCCCTATAGG - Intronic
913342157 1:117769382-117769404 ACTGGGAAACACCTCCCAGTAGG - Intergenic
913363074 1:118004231-118004253 ACTGGGAGACACCTCCCAGTAGG - Intronic
913473528 1:119214826-119214848 ACTGGGAGACACCTCCCAGTAGG - Intergenic
913512531 1:119574584-119574606 ACTGGAAAACACCTCCCAGTAGG + Intergenic
913566754 1:120080270-120080292 AAGATCCAACACCTCCCATTGGG - Intergenic
913607448 1:120478883-120478905 ACTGGGAGACACCTCCCAGTAGG + Intergenic
913631378 1:120713282-120713304 AAGATCCAACACCTCCCATTGGG + Intergenic
913987898 1:143582692-143582714 ACTGGGAGACACCTCCCAGTAGG - Intergenic
914208978 1:145561256-145561278 ACTGGGAGACACCTCCCAGTAGG - Intergenic
914287509 1:146240977-146240999 AAGATCCAACACCTCCCATTGGG - Intergenic
914369196 1:147007237-147007259 ACTGGGAGACACCTCCCAGTAGG + Intergenic
914548541 1:148691719-148691741 AAGATCCAACACCTCCCATTGGG - Intergenic
914583744 1:149042951-149042973 ACTGGGAGACACCTCCCAGTAGG - Intronic
914618137 1:149379992-149380014 AAGATCCAACACCTCCCATTGGG + Intergenic
915077285 1:153319720-153319742 ACTGGGAGACACCTCCCAGTAGG - Intergenic
915771702 1:158432472-158432494 ACTAGGAGACACCTCCCAGCAGG - Intergenic
915976080 1:160390315-160390337 ACTGGGAGACACCTCCCAGTTGG - Intergenic
916251916 1:162746702-162746724 ACTGGGAGACACCTCCCAGTAGG + Intronic
916469459 1:165108966-165108988 ACTGGGAGACACCTCCCAGTAGG - Intergenic
916645847 1:166784554-166784576 ACTGGGTGACACCTCCCAGTAGG - Intergenic
916915426 1:169401382-169401404 ACTGGGAGACACCTCCCAGTAGG + Intronic
916957316 1:169852509-169852531 ACTATGCAGCACTTCTCATTGGG + Intronic
917181486 1:172302598-172302620 ACTGGGAGACACCTCCCAGTAGG + Intronic
917192469 1:172432318-172432340 ACTGGGAGACACCTCCCAGTAGG + Intronic
917308745 1:173655532-173655554 ACTGGGAGACACCTCCCAGTAGG - Intronic
917464287 1:175261655-175261677 ACTGGGAGACACCTCCCAGTAGG - Intergenic
917573628 1:176296508-176296530 ACTGGGAGACACCTCCCAGTAGG - Intergenic
917893688 1:179465529-179465551 ACTGGGAGACACCTCCCAGTAGG - Intronic
917903945 1:179571485-179571507 ACTGGGAGACACCTCCCAGTAGG - Intronic
917915295 1:179695051-179695073 ACTGGGAAACACCTCCCAGCAGG + Intergenic
918327299 1:183422183-183422205 ACTAGGCACCACCTCCAACGTGG - Intergenic
919065441 1:192688134-192688156 ACTGGGAGACACCTCCCAGTAGG - Intergenic
919332821 1:196192989-196193011 ACTGGGAAACACCTCCCAGTAGG - Intergenic
919391547 1:196991804-196991826 ACTGGGAGACACCTCCCAGTAGG - Intronic
919436824 1:197572639-197572661 ACTGGGAGACACCTCCCAGTAGG + Intronic
919603223 1:199648045-199648067 ACTGGGAGACACCTCCCATTAGG + Intergenic
920588862 1:207196662-207196684 ACTGGGAGACACCTCCCAGTAGG + Intergenic
920631881 1:207660250-207660272 ACTGGGAGACACCTCCCAATAGG + Intronic
920781141 1:208992155-208992177 ACTGGGAGACATCTCCCATTAGG + Intergenic
920993103 1:210959334-210959356 ACTGGGACACACCTCCCAGTAGG - Intronic
921004175 1:211076311-211076333 ACTTGGAGACACCTCCCAGTAGG + Intronic
921401312 1:214727122-214727144 ACTAGGAGACACTTCCCAGTAGG - Intergenic
921461477 1:215432576-215432598 ACTAGGAGACACCTCCCATTAGG - Intergenic
921915971 1:220610991-220611013 ACTGGGAGACACCTCCCAGTAGG - Intronic
922397474 1:225217309-225217331 ACTGGGAGACACCTCCCAGTAGG - Intronic
922552285 1:226504689-226504711 ACTGGGAGACACCTCCCAGTAGG - Intergenic
922641087 1:227232820-227232842 ACTGGGAGACACCTCCCAGTAGG - Intronic
923066895 1:230526704-230526726 ACTGGGAGACACCTCCCAGTAGG - Intergenic
924296091 1:242587650-242587672 ACTGGGAGACACCTCCCAGTAGG + Intergenic
924629622 1:245724395-245724417 ACTGGGTAAGACCTCCCAATAGG + Intergenic
924631587 1:245745681-245745703 ACTAGGAGACACCTCCCAGTAGG - Intergenic
924828948 1:247572643-247572665 ACAAGGAAACACCTCCCAACAGG - Intronic
1064426241 10:15232146-15232168 ACTAAGCAACACATCCCTCTAGG - Intronic
1064431127 10:15270610-15270632 ACTGGGAGACACCTCCCAGTAGG + Intronic
1064492825 10:15877934-15877956 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1064518590 10:16177009-16177031 ACTGGGAGACACCTCCCAATAGG - Intergenic
1065230998 10:23598526-23598548 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1065473025 10:26102808-26102830 ACCAGGAGACACCTCCCAGTAGG - Intronic
1066236464 10:33489792-33489814 ATCGGGCAACCCCTCCCATTTGG + Intergenic
1066751314 10:38659882-38659904 ACTGGGACACACCTCCCAGTAGG + Intergenic
1066965729 10:42263209-42263231 ACTGGGACACACCTCCCAGTAGG - Intergenic
1068149308 10:53111976-53111998 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1068169123 10:53370808-53370830 ACTGGGAGACAACTCCCATTAGG + Intergenic
1068477912 10:57551690-57551712 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1068495401 10:57779558-57779580 ACTGGGAAAGACCTCCCAGTAGG + Intergenic
1068567669 10:58593441-58593463 ACTGGGAGACACCTCCCAGTAGG + Intronic
1068609483 10:59043275-59043297 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1068646248 10:59471054-59471076 ACTGGGAGACACCTCCCAGTTGG + Intergenic
1068789109 10:61008298-61008320 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1069188955 10:65463836-65463858 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1069227137 10:65958800-65958822 ACTGGGAGACACCTCCCAGTAGG - Intronic
1069264222 10:66438137-66438159 ACTAGGAAACACCTCCCAGCAGG - Intronic
1069734512 10:70644900-70644922 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1070007228 10:72436116-72436138 ACTGGGAGACACCTCCCAGTAGG + Intronic
1070343599 10:75521122-75521144 ACTGGGAGACACCTCCCAGTAGG - Intronic
1070349342 10:75576572-75576594 ACCAGGAGACACCTCCCAGTAGG + Intronic
1070632562 10:78097073-78097095 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1070851904 10:79571077-79571099 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1071066680 10:81644381-81644403 ACTGGGCAATACCTCCCAGCAGG - Intergenic
1071190131 10:83089881-83089903 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1071193927 10:83134881-83134903 ACTGGGAGACACCTCCCAGTGGG - Intergenic
1071349711 10:84727830-84727852 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1071698435 10:87903265-87903287 ACTGGGAGACACCTCCCAGTAGG - Intronic
1072245038 10:93535698-93535720 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1072477565 10:95777570-95777592 ACTGGGAGACACCTCCCAGTAGG - Intronic
1072480503 10:95806926-95806948 ACTGGGAGACACCTCCCAGTAGG - Intronic
1072516183 10:96185727-96185749 ACTGGGAGACACCTCCCAGTAGG - Intronic
1072872369 10:99133439-99133461 ACTGGGAGACACCTCCCAGTAGG + Intronic
1073022293 10:100455174-100455196 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1073745931 10:106467954-106467976 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1073927415 10:108533167-108533189 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1074016688 10:109542010-109542032 ACTAGGTGAAACCTCCCAGTAGG - Intergenic
1074017190 10:109546039-109546061 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1076397746 10:130153716-130153738 ACTGGGAGACACCTCCCAGTAGG - Intronic
1076423601 10:130351610-130351632 ACTGGGCAAGGCCTCCCACTGGG + Intergenic
1076590898 10:131581386-131581408 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1076965322 11:77849-77871 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1077655623 11:4016466-4016488 ACTGGGAGACACCTCCCAGTAGG - Intronic
1078121704 11:8517065-8517087 ACTGGGAAACGCCTCCCAGTAGG + Intronic
1078283879 11:9931332-9931354 ACTGGGAGACACCTCCCAGTAGG + Intronic
1078336430 11:10466742-10466764 ACTGGGAGACACCTCCCAGTAGG + Intronic
1078394110 11:10963921-10963943 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1078482678 11:11692243-11692265 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1078560464 11:12366672-12366694 ACTGGGAAACATCTCCCAGTAGG + Intergenic
1078681482 11:13480654-13480676 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1078697814 11:13651972-13651994 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1078732826 11:13991999-13992021 ACTGGGAGACACCTCCCAGTAGG - Intronic
1079301120 11:19279718-19279740 ATGACCCAACACCTCCCATTAGG + Intergenic
1079577869 11:22025666-22025688 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1079909580 11:26292843-26292865 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1079977044 11:27104825-27104847 ACTGGGAGACACCGCCCATTAGG + Intronic
1080059279 11:27939794-27939816 ACTAGGAAGCACCCCCCAGTAGG + Intergenic
1080235797 11:30067042-30067064 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1080365986 11:31574517-31574539 ACTGGGACACACCTCCCAGTAGG + Intronic
1080917449 11:36674122-36674144 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1080924566 11:36742871-36742893 ACTTGGCTACACCTCCCACTTGG + Intergenic
1080977216 11:37357267-37357289 ACTGGGAAACACCTCCCAATAGG + Intergenic
1081587370 11:44396629-44396651 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1082614233 11:55338911-55338933 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1082860268 11:57848556-57848578 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1082968119 11:58989358-58989380 ACTGGGAGACACCTCCCAGTAGG - Intronic
1083003624 11:59320901-59320923 ACTTGGAGACACCTCCCATTAGG - Intergenic
1083008641 11:59372735-59372757 ACTTGGAAACACCTCCCAGTAGG + Intergenic
1083165311 11:60881475-60881497 ACTGGGAGACACCTCCCAATAGG + Intergenic
1083324391 11:61866070-61866092 ACTAGGCATCACCCCCGCTTTGG + Exonic
1083501685 11:63114980-63115002 ACTGGGAGACACCTCCCAGTAGG - Intronic
1083509364 11:63193366-63193388 ACTGGGAGACACCTCCCAATAGG + Intronic
1085003454 11:73062010-73062032 ACTGGGAGACACCTCCCAGTAGG + Intronic
1085133261 11:74060351-74060373 ACTGGGAGACACCTCCCAGTAGG + Intronic
1085433932 11:76481948-76481970 ACTGGGAGACACCTCCCAGTAGG + Intronic
1085800764 11:79586791-79586813 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1085827727 11:79865411-79865433 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1086298272 11:85395992-85396014 ACTGGGAAACACCTCCCAGTAGG + Intronic
1086307416 11:85496647-85496669 ACTGGGAGACACCTCCCAGTAGG + Intronic
1086312224 11:85548428-85548450 ACTGGGAGACACCTCCCAGTAGG - Intronic
1086494412 11:87387222-87387244 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1086608516 11:88725586-88725608 ACTGGGAGACACCTCCCATCAGG + Intronic
1086869022 11:92014955-92014977 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1087003402 11:93444467-93444489 ACTGGGGGACACCTCCCACTTGG - Intergenic
1087089031 11:94248767-94248789 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1087100525 11:94359424-94359446 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1087311196 11:96545708-96545730 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1087364152 11:97198122-97198144 ACTGGGAAATACCTCCCAGTAGG - Intergenic
1087410603 11:97786012-97786034 ACTGGGGGACACCTCCCAGTAGG - Intergenic
1087482362 11:98717872-98717894 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1087718529 11:101636378-101636400 ACTGGGCAAGACCTCCCTGTGGG + Intronic
1087898328 11:103612039-103612061 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1087925225 11:103911284-103911306 ACTGGGAGACATCTCCCATTAGG + Intronic
1088004598 11:104925751-104925773 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1088034556 11:105296174-105296196 ACTAGGAGACACCTCCCAACAGG - Intergenic
1088078238 11:105878354-105878376 ACTGGGAGACACCTCCCAGTAGG - Intronic
1088381011 11:109192777-109192799 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1088656714 11:112006513-112006535 ACTGGGAGACACCTCCCAGTAGG + Intronic
1088691308 11:112331016-112331038 ACTAGGAGACACCTCCCACTAGG - Intergenic
1088859150 11:113783707-113783729 TCTAGGCAACCCATCCCATGAGG - Intergenic
1090103732 11:123829633-123829655 ACTAGGAGACGCCTCCCAGTAGG - Intergenic
1090216256 11:124968070-124968092 ACTGGGAGACACCTCCCAGTAGG - Intronic
1090932775 11:131313257-131313279 ACTCGGAGACACCTCCCAGTAGG + Intergenic
1090946963 11:131439223-131439245 ACTGGGAGACACCTCCCAGTAGG - Intronic
1091867313 12:3851838-3851860 ACTGGGAGACACCTCCCAGTAGG + Intronic
1092327111 12:7544336-7544358 ACTAGCAAACACCTCCCAATAGG + Intergenic
1092332217 12:7594914-7594936 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1092560819 12:9611039-9611061 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1092661873 12:10747651-10747673 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1093086284 12:14869398-14869420 ACTGGGCAGGACCTCCCATCTGG - Intronic
1093649516 12:21626998-21627020 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1093992839 12:25609759-25609781 ACTTGGAGACACCTCCCAGTAGG - Intronic
1094482277 12:30894474-30894496 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1094733034 12:33200292-33200314 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1094760020 12:33521441-33521463 ACTAGGAGACACTTCCCAGTAGG + Intergenic
1095128388 12:38508701-38508723 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1095140604 12:38657604-38657626 ACTGGGAGACACCTCCCAGTAGG + Intronic
1095356495 12:41280914-41280936 ACTAGGAGACACCTCCCAGCAGG + Intronic
1095401341 12:41817955-41817977 ACCAGGCGTCACCTCCCACTAGG - Intergenic
1095442725 12:42254301-42254323 ACTGGGAGACACCTCCCAGTAGG - Intronic
1095694929 12:45133203-45133225 ACTAGAAGACACCTCCCAGTAGG + Intergenic
1095720265 12:45392576-45392598 ACTGGGAAACACCTACCACTGGG + Intronic
1095830905 12:46585740-46585762 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1095871238 12:47030511-47030533 ACAAGGCCCCACCTCCAATTGGG - Intergenic
1095913885 12:47457207-47457229 ACTAGGAGACATCTCCCAGTAGG - Intergenic
1096030492 12:48409843-48409865 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1096941923 12:55355929-55355951 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1097139527 12:56888584-56888606 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1097148576 12:56958946-56958968 ACTGGGAGACACCTCCCAGTAGG + Intronic
1097301322 12:58022547-58022569 ACCAGGAGACACCTCCCAGTAGG - Intergenic
1097364980 12:58702028-58702050 ACTGGGAGACACCTCCCAGTAGG + Intronic
1097701060 12:62820473-62820495 ACTGGGAGGCACCTCCCATTAGG + Intronic
1097749636 12:63337596-63337618 ACTGGGAGACACCTCCCAATAGG + Intergenic
1097917427 12:65035862-65035884 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1098438713 12:70496658-70496680 ACTGGGAGACACCTCCCAGTGGG - Intergenic
1098638453 12:72812976-72812998 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1098993847 12:77095869-77095891 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1099030905 12:77524485-77524507 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1099261339 12:80386557-80386579 ACTGGGAAGCACCTCCCAGTAGG + Intergenic
1099314328 12:81065407-81065429 ACTGGGAGACACCTCCCAGTAGG + Intronic
1099428230 12:82550625-82550647 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1099486181 12:83232248-83232270 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1099703553 12:86120473-86120495 ACTGGGAGACACCTCCCAGTAGG + Intronic
1099779179 12:87172120-87172142 ACTAGGAGACACCTCTCAGTAGG + Intergenic
1099806950 12:87531674-87531696 ACTGGGAGACACCTCCCAGTGGG + Intergenic
1100248511 12:92789848-92789870 ACTGGGAGACACCTCCCAATAGG + Intronic
1100381400 12:94064975-94064997 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1100766005 12:97866269-97866291 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1100781241 12:98028841-98028863 AGTTGGCAGCAACTCCCATTCGG - Intergenic
1100907734 12:99321112-99321134 ACTGGGAGACACCTCCCAGTAGG - Intronic
1101301663 12:103489368-103489390 ACTGGGAGACACCTCCCATTAGG - Intronic
1101361869 12:104034869-104034891 ACTGGGAGACACCTCCCAGTAGG + Intronic
1101570458 12:105948879-105948901 ACTCAGCACCATCTCCCATTGGG + Intergenic
1101636883 12:106551325-106551347 ACTGGGAGACACCTCCCAGTAGG - Intronic
1102345504 12:112158633-112158655 ACTGGGAAACACCTCCCAGCAGG - Intergenic
1103154622 12:118674016-118674038 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1103255382 12:119537833-119537855 ACTGGGAGACACCTCCCAGTAGG - Intronic
1104086334 12:125477818-125477840 ACTGGGAGACACCTCCCAGTAGG + Intronic
1104175327 12:126326072-126326094 ACTTGGAGACACCTCCCATTTGG - Intergenic
1105756382 13:23467773-23467795 ACTAGGCAACCCCTAGCCTTGGG - Intergenic
1106153206 13:27126200-27126222 ACTGGGAGACACCTCCCAGTAGG + Intronic
1106608139 13:31250914-31250936 ACTGGGAGACACCTCCCAGTAGG + Intronic
1106816927 13:33418667-33418689 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1106960066 13:34988211-34988233 ACTGGGAGACACCTCCCAGTAGG - Intronic
1107355071 13:39557725-39557747 ACTATCCGACACCTCCCATGAGG - Intronic
1108236907 13:48417126-48417148 ACTGGGAAACACCTCCCAGCAGG + Intronic
1108264959 13:48697243-48697265 ACTGGGAAAAACCTCCCAGTAGG + Intronic
1108308518 13:49163047-49163069 ACTGGGAGACACCTCCCAGTAGG - Intronic
1108474715 13:50802320-50802342 ATTTGGAAATACCTCCCATTTGG + Intronic
1108549288 13:51527102-51527124 ACTAGGAAACACCTCCCAGTAGG + Intergenic
1108865461 13:54917835-54917857 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1108892440 13:55277984-55278006 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1108988818 13:56629397-56629419 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1109385873 13:61628732-61628754 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1109465776 13:62729635-62729657 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1109659188 13:65436108-65436130 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1110071606 13:71184988-71185010 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1110199654 13:72833688-72833710 ACTGGGAGACACCTCCCAGTAGG - Intronic
1110510338 13:76343005-76343027 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1110606900 13:77443275-77443297 ACTCGGAGACACCTCCCAGTAGG - Intergenic
1110699187 13:78526770-78526792 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1111932675 13:94527357-94527379 ACTGGGAAACATCTCCCAGTAGG + Intergenic
1112232434 13:97602576-97602598 ACTTGGAGACACCTCCCAATAGG + Intergenic
1112412003 13:99172742-99172764 ACTCGGAGACACCTCCCAGTAGG - Intergenic
1113300912 13:109018404-109018426 ACTTGGAGACACCTCCCAGTAGG - Intronic
1113383778 13:109828789-109828811 ACTGGGATACACCTCCCAGTAGG - Intergenic
1113488153 13:110670290-110670312 ACTGGGAGACACCTCCCAGTAGG + Intronic
1114432841 14:22677447-22677469 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1114433863 14:22686710-22686732 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1114747696 14:25167805-25167827 ACTGGGAAGCACCTCCCAGTAGG + Intergenic
1114784890 14:25585497-25585519 ACTGGGAAACACTTCCCAGTAGG - Intergenic
1114796498 14:25720969-25720991 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1114844961 14:26309613-26309635 ACTGGGAAACACCTCCCAGCAGG + Intergenic
1114964412 14:27939654-27939676 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1115135915 14:30107659-30107681 ACTGGGAGACACCTCCCAGTAGG + Intronic
1115265444 14:31495100-31495122 ACTGGGAAACACCTCCCAGCAGG + Intronic
1115276987 14:31620721-31620743 ACTGGGAGACACCTCCCAGTAGG - Intronic
1115584656 14:34798403-34798425 ACTGGGAGACACCTCCCAGTAGG + Intronic
1115743253 14:36410092-36410114 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1115818497 14:37188483-37188505 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1115843712 14:37502324-37502346 ACTGGGAGACACCTCCCAGTAGG + Intronic
1115954683 14:38764744-38764766 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1116052796 14:39825449-39825471 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1116165514 14:41329787-41329809 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1116212673 14:41968231-41968253 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1116236433 14:42285041-42285063 ACTGGGAAACCCCTCCCAGTAGG - Intergenic
1116727183 14:48575666-48575688 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1117123633 14:52596239-52596261 ACTGGGAGACACCTCCCAGTAGG - Intronic
1117170092 14:53085351-53085373 ACTGGGAGACACCTCCCAGTAGG + Intronic
1117511426 14:56455169-56455191 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1117617008 14:57544507-57544529 ACTAGGAGACATCTCCCAGTAGG - Intergenic
1117887698 14:60382327-60382349 GCTGGGCGACACCTCCCAGTAGG + Intergenic
1117900584 14:60528676-60528698 ACTGGGAAACACCTCTCAGTAGG - Intergenic
1118494699 14:66296496-66296518 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1118498521 14:66333439-66333461 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1118544789 14:66873954-66873976 ACTAGGAAACACCTCCCAGCAGG + Intronic
1119930518 14:78542089-78542111 ACTGGGAGACACCTCCCAGTAGG - Intronic
1120065807 14:80039501-80039523 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1120559590 14:85974473-85974495 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1120619857 14:86750412-86750434 ACTTGGCGACACCTCCCAGTAGG - Intergenic
1121213958 14:92232847-92232869 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1122443301 14:101749641-101749663 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1123884327 15:24709461-24709483 ACTAGGAGACACCTCCCAGCAGG + Intergenic
1124885758 15:33684213-33684235 ACTGGGAGACACCTCCCAGTAGG + Intronic
1124948352 15:34292407-34292429 ACTAGGAGACATCTCCCAGTAGG - Intronic
1125219909 15:37320672-37320694 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1125330964 15:38581434-38581456 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1125779445 15:42251663-42251685 ACTGGGAGACACCTCCCAGTAGG - Intronic
1125784370 15:42302053-42302075 ACTAGGAGACACCTCCCAGCAGG + Intronic
1126060428 15:44775925-44775947 ACTTTGCAGCATCTCCCATTAGG + Intergenic
1126071263 15:44866474-44866496 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1126520873 15:49592604-49592626 ACTGGGAGACACCTCCCAGTAGG - Intronic
1126742137 15:51787579-51787601 ACTGGGAGACACCTCCCAGTAGG + Intronic
1127021151 15:54749972-54749994 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1127158109 15:56150360-56150382 ACTAGGAGACACCTCCCAGATGG + Intronic
1127524975 15:59784100-59784122 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1127570663 15:60237879-60237901 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1127971136 15:63962758-63962780 ACTGGGAGACACCTCCCAATAGG - Intronic
1128339786 15:66813420-66813442 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1128696636 15:69769721-69769743 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1129126839 15:73448699-73448721 ACTGGGAGACACCTCCCAGTAGG + Intronic
1129796467 15:78381358-78381380 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1130697792 15:86147834-86147856 ACTGGGAGACACCTCCCAGTAGG + Intronic
1130703624 15:86211254-86211276 ACTGGGAGACACCTCCCAGTAGG - Intronic
1132287891 15:100679002-100679024 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1132442804 15:101885672-101885694 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1133705178 16:8347744-8347766 AATAGACTACACCTCCCAGTGGG + Intergenic
1133956917 16:10452543-10452565 ACTGGGAGACACCTCCCAGTAGG - Intronic
1134767546 16:16774179-16774201 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1135512120 16:23094575-23094597 ACTGGGAGACACCTCCCAGTAGG + Intronic
1136779927 16:32891558-32891580 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1136890686 16:33969962-33969984 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1137324936 16:47424853-47424875 ACTAGGAGACACCTCCCAGCAGG - Intronic
1137370159 16:47897543-47897565 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1137471127 16:48759418-48759440 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1138713163 16:58992663-58992685 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1138734096 16:59230369-59230391 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1138843579 16:60538712-60538734 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1140383613 16:74513366-74513388 ACTGGGAGACACCTCCCAGTAGG + Intronic
1140695196 16:77525662-77525684 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1141164689 16:81652585-81652607 ACGGGGCAACACCTCCTCTTCGG - Intronic
1203082346 16_KI270728v1_random:1153646-1153668 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1142936935 17:3342697-3342719 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1144294082 17:13856198-13856220 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1146145450 17:30412294-30412316 ACTGGGAGACACCTCCCAGTAGG - Intronic
1146172536 17:30644985-30645007 AGTAGGCTCCACCTCCCAGTGGG + Intergenic
1146345990 17:32060994-32061016 AGTAGGCTCCACCTCCCAGTGGG + Intergenic
1147902445 17:43797900-43797922 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1148442972 17:47721269-47721291 TCGAGGAAACACCTCCCTTTAGG + Intergenic
1148950373 17:51305647-51305669 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1149055338 17:52356667-52356689 ACTAGGAGACACCTCCCAGGAGG - Intergenic
1149093798 17:52816841-52816863 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1149191884 17:54072820-54072842 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1149212257 17:54317081-54317103 ACTGGAAAACACCTCCCAGTAGG + Intergenic
1149932004 17:60766612-60766634 ACTTGGAGACACCTCCCAGTAGG - Intronic
1150025898 17:61673752-61673774 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1150039427 17:61843485-61843507 ACTAGGCCCCACCTCCAACTTGG - Intronic
1150094158 17:62357649-62357671 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1150531175 17:65983465-65983487 ATAAGCCAACACCTCCCACTAGG - Intronic
1151675515 17:75595410-75595432 ACTAAGCAACTCCTCCCAGCAGG - Intergenic
1152954760 18:28786-28808 ACTGGGCAAGACCTCCCAACAGG + Intergenic
1153419249 18:4885924-4885946 ACTGGGAAACATCTCCCAGTAGG - Intergenic
1153441326 18:5122710-5122732 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1153743208 18:8151069-8151091 ACTAGGAGACACCTCCCAGTAGG - Intronic
1153941521 18:9982554-9982576 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1154364125 18:13690487-13690509 ACTGGGAGACACCTCCCAGTAGG + Intronic
1154382165 18:13862679-13862701 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1155350610 18:24901855-24901877 ACTGGGAGACACCTCCCAATAGG + Intergenic
1155562430 18:27093162-27093184 ACTGGGAGACACCTCCCAGTAGG - Intronic
1155659240 18:28228413-28228435 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1155665117 18:28298964-28298986 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1155916551 18:31563367-31563389 ACTAGTCCAATCCTCCCATTAGG + Intergenic
1156434514 18:37112255-37112277 ACTGGGAGACACCTCCCAATAGG + Intronic
1156443797 18:37219249-37219271 ACTGGGAGACACCTCCCAGTAGG - Intronic
1157025360 18:43836199-43836221 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1157036798 18:43984688-43984710 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1157066478 18:44356627-44356649 ACTGGGAAACACTTCCCAGTAGG - Intergenic
1157123375 18:44933359-44933381 ACTGGGAGACACCTCCCAGTAGG - Intronic
1157336511 18:46742790-46742812 ACTGGGAGACACCTCCCAGTAGG + Intronic
1157561518 18:48649680-48649702 ACTGGGAAACACCTCCCAGTAGG + Intronic
1157695037 18:49715902-49715924 ACTGGGAGACACCTCCCAGTGGG - Intergenic
1157787890 18:50502500-50502522 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1158073070 18:53496159-53496181 ACTGGGAGACACCTCCCAGTTGG + Intronic
1158145669 18:54309505-54309527 ACTTGGAGACACCTCCCAGTAGG - Intronic
1159443288 18:68508807-68508829 AGTAGGCAGCACTTCCAATTTGG - Intergenic
1159645730 18:70916196-70916218 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1160642126 19:147479-147501 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1162989897 19:14295095-14295117 AATAGGCTCCACCTCCCAGTGGG - Intergenic
1163858510 19:19726493-19726515 ACTGGGAGACACCTCCCAATAGG - Intronic
1164085584 19:21899387-21899409 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1164091403 19:21956244-21956266 ACTGGGAGACACCTCCCAGTAGG - Intronic
1164133133 19:22384358-22384380 ACTAGGCAACACCTCCCAGTAGG - Intergenic
1164165681 19:22672400-22672422 ACTAGGCAACACCTCCCAGTAGG + Intergenic
1164495572 19:28757565-28757587 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1164556234 19:29254922-29254944 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1165973099 19:39649894-39649916 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1166087046 19:40483269-40483291 ACTAGCCAAAACCTGCTATTTGG + Intronic
1166087077 19:40483735-40483757 ACTAGCCAAAACCTGCTATTTGG - Intronic
1166240329 19:41487059-41487081 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1168170488 19:54585199-54585221 ACTGGGAAACACCTCCCAGTAGG - Intronic
925172805 2:1760639-1760661 ACTGGGAGACACCTCCCAGTAGG + Intergenic
925673116 2:6332942-6332964 ACTTGGAGACACCTCCCAGTAGG - Intergenic
926366537 2:12138878-12138900 ACTGGGAGACACCTCCCAGTAGG - Intergenic
926941705 2:18144573-18144595 ACTGGGAGACACCTCCCAGTAGG - Intronic
927011695 2:18910947-18910969 ATGACCCAACACCTCCCATTAGG - Intergenic
927117235 2:19916928-19916950 ACTAGGAAACACCTCCCAGTGGG + Intronic
927730044 2:25463105-25463127 TCTACTCAACACCTCCCCTTGGG + Intronic
928462276 2:31485799-31485821 ACTAGGCAGAACCTCCCACTGGG - Intergenic
928480976 2:31683439-31683461 ACTGGGAAATACCTCCCAGTAGG - Intergenic
928494631 2:31819543-31819565 ACTAGGCCCCACCTCCAATACGG + Intergenic
928750724 2:34467211-34467233 ACTAGGAGACACCTCCCAGCAGG + Intergenic
928883350 2:36122173-36122195 ACTGGGTAACACCTCCCAACAGG - Intergenic
930143204 2:47974224-47974246 ACTGGGAGACACCTCCCAGTAGG + Intergenic
930223279 2:48767284-48767306 ACTGGGAGACACCTCCCAGTAGG - Intronic
930264659 2:49185936-49185958 ACTAGGAGATACCTCCCAGTAGG - Intergenic
930266905 2:49210599-49210621 ACTGGGAGACACCTCCCAGTAGG + Intergenic
930274874 2:49299173-49299195 ACTGGGAGACACCTCCCAGTAGG + Intergenic
930516048 2:52409586-52409608 ACTGGGAGACACCTCCCAGTAGG - Intergenic
930840146 2:55836961-55836983 ACTGGGAGACACCTCCCAGTAGG - Intergenic
930925815 2:56816837-56816859 ACTGGGAAAGACCTCCCAATAGG + Intergenic
930941829 2:57022892-57022914 ACTGGGAGACACCTCCCAATTGG + Intergenic
931074029 2:58689192-58689214 ACTAGGAGACACCTCCCAGCAGG + Intergenic
931305222 2:61021747-61021769 ACTGGGAAACACCTCCCAGTAGG + Intronic
931558529 2:63531420-63531442 ACTGGGAGACACCTCCCAGTAGG + Intronic
931594563 2:63927234-63927256 ACTGGGAGACACCTCCCAGTAGG + Intronic
931698786 2:64891743-64891765 ACTGGGAGACACCTCCCAGTAGG + Intergenic
931885700 2:66615040-66615062 ACTGGGAGACACCTCCCAGTAGG - Intergenic
932323996 2:70842898-70842920 ACTGGGAGACACCTCCCAGTAGG + Intergenic
932511733 2:72299961-72299983 ACTGGGAGACACCTCCCACTAGG - Intronic
932662622 2:73669911-73669933 ACTGGGAGACATCTCCCATTAGG - Intergenic
933094599 2:78162256-78162278 ACTGGGAGACACCTCCCAGTAGG - Intergenic
933595019 2:84274546-84274568 TCTGGGCAACACCTCCCAGGAGG - Intergenic
933603249 2:84354641-84354663 ACTGGGAGACACCTCCCAGTAGG + Intergenic
934314304 2:91902034-91902056 ACTGGGACACACCTCCCAGTAGG + Intergenic
934531653 2:95093435-95093457 ACTGGGAGACACCTCCCACTAGG + Intronic
934617124 2:95779182-95779204 ACTGGGAGACACCTCCCAGTAGG + Intergenic
934643769 2:96045377-96045399 ACTGGGAGACACCTCCCAGTAGG - Intergenic
934837185 2:97601471-97601493 ACTGGGAGACACCTCCCAGTAGG - Intergenic
935145910 2:100395344-100395366 GCTAAGCTACACCCCCCATTCGG - Intronic
935565998 2:104608041-104608063 ACTGGGAGACACCTCCCAGTAGG + Intergenic
936142683 2:109953650-109953672 ACTTGGAGACACCTCCCAGTAGG + Intergenic
936179371 2:110251615-110251637 ACTTGGAGACACCTCCCAGTAGG + Intergenic
936202005 2:110417817-110417839 ACTTGGAGACACCTCCCAGTAGG - Intronic
936448262 2:112614400-112614422 ACTGGGAGACACCTCCCAGTTGG - Intergenic
936649821 2:114413409-114413431 ACTGGGAAACACCTCCCAGTAGG - Intergenic
936806376 2:116337245-116337267 ACTGGGAGACACCTCCCAGTAGG - Intergenic
936823584 2:116553501-116553523 ACTTGGAGACACCTCCCAGTAGG + Intergenic
936909931 2:117579938-117579960 ACTGGGAGACACCTCCCAGTAGG + Intergenic
937573591 2:123392376-123392398 ACTGGGAGACACCTCCCAGTAGG + Intergenic
937632957 2:124123637-124123659 ACTGGGAGACACCTCCCAGTAGG + Intronic
937792517 2:125977693-125977715 ACTAGGCATCATCTCCCCCTAGG - Intergenic
938559334 2:132457549-132457571 ACTGGGAGACACCTCCCAGTAGG - Intronic
939019890 2:136946399-136946421 ACTGGGAGACACCTCCCAGTAGG - Intronic
939193331 2:138942387-138942409 ACTGGGAAACATCTCCCAGTAGG - Intergenic
939730887 2:145783091-145783113 ACTTGGAGACACCTCCCAGTAGG + Intergenic
939744422 2:145951618-145951640 ACTGGGAGACACCTCCCAGTAGG - Intergenic
939974838 2:148705556-148705578 ACTTGGAGACACCTCCCAGTAGG + Intronic
940001395 2:148969801-148969823 ACTAGGCAAGACCTGACACTAGG - Intronic
940257271 2:151744054-151744076 ACTGGGGGACACCTCCCAGTAGG + Intergenic
940720706 2:157279240-157279262 ACTGGGAGACACCTCCCAGTAGG - Intronic
940995884 2:160149175-160149197 ACTGGGAGACACCTCCCAGTAGG + Intronic
941523840 2:166581925-166581947 ACTGGGAGACACCTCCCAGTAGG + Intergenic
941767439 2:169313618-169313640 ACTGGGAGACACCTCCCAGTAGG - Intronic
942065750 2:172270147-172270169 ACTGGGAGACACCTCCCAGTAGG - Intergenic
942107655 2:172649066-172649088 ACTGGGAGACACCTCCCAGTAGG + Intergenic
942576914 2:177373639-177373661 ACTAGGAGACACCTCCCAGCAGG - Intronic
942722301 2:178966318-178966340 ACTGGGAGACACCTCCCAGTAGG + Intronic
942753625 2:179315210-179315232 ACTGGGAGACACCTCCCAGTAGG + Intergenic
942779972 2:179630242-179630264 ACTGGGAGACACCTCCCAGTAGG + Intronic
942958661 2:181803984-181804006 ACTGGGAGACACCTCCCAGTAGG - Intergenic
943299956 2:186186287-186186309 ACTGGGAGACACCTCCCAGTGGG - Intergenic
943350781 2:186793702-186793724 ACTGGGAGACACCTCCCAGTAGG + Intergenic
943552416 2:189357173-189357195 ACTGGGAAACACCTCCCAGTAGG - Intergenic
943558258 2:189430899-189430921 ACTGGGAGACACCTCCCAGTAGG + Intergenic
943583571 2:189712324-189712346 ACTGGGAGACACCTCCCAGTAGG + Intronic
943599074 2:189892672-189892694 ACTAGGAGACACCTCCCAGCAGG - Intronic
943660562 2:190554858-190554880 ACTGGGAGACACCTCCCAATAGG + Intergenic
943665029 2:190600459-190600481 ACTATGCCACACCTCCCAACAGG - Intergenic
943704254 2:191018331-191018353 ACTACTCCACACTTCCCATTTGG + Intronic
943716828 2:191161271-191161293 ACTGGGAGACACCTCCCAGTAGG + Intergenic
944033829 2:195269131-195269153 ACTGGGAGACACCTCCCAGTAGG - Intergenic
944107018 2:196089882-196089904 ACTGGGAGACACCTCCCAGTAGG + Intergenic
944165032 2:196709927-196709949 ACTGGGAGACACCTCCCAGTAGG - Intronic
944347465 2:198685503-198685525 ACTGGGAAACACCTCCCAGTAGG + Intergenic
944520945 2:200566478-200566500 ACTGGGAGACACCTCCCAGTAGG - Intronic
944608002 2:201370316-201370338 ACTGGGAGACACCTCCCAGTAGG + Intergenic
944629897 2:201613285-201613307 ACTGGGAGACACCTCCCAGTAGG + Intronic
944983916 2:205153195-205153217 ACTGGGAGACACCTCCCAGTAGG - Intronic
945116709 2:206415489-206415511 ACTGGGAGACACCTCCCAGTAGG - Intergenic
945161810 2:206899626-206899648 ACTGGGAGACACCTCCCAGTAGG - Intergenic
945390732 2:209262112-209262134 ACTGGGAGACACCTCCCAGTAGG + Intergenic
945486824 2:210406652-210406674 ACTGGGAGACACCTCCCAGTAGG - Intergenic
945597421 2:211812457-211812479 ACTGGGAGACACCTCCCAGTAGG - Intronic
945716056 2:213359192-213359214 ACTGGGAGACACCTCCCAGTAGG - Intronic
945805859 2:214488946-214488968 ATCACCCAACACCTCCCATTAGG + Intronic
946205833 2:218107975-218107997 ACTGGGAGACACCTCCCAGTAGG - Intergenic
946719110 2:222585074-222585096 ACTAGGAGATACCTCCCAGTAGG + Intronic
946834426 2:223758645-223758667 AATAAGCAACGCCTCCCATCCGG - Exonic
947098321 2:226591850-226591872 ACTGGGCAAGACCTCCCTGTCGG - Intergenic
947194317 2:227545900-227545922 ACTGGGAGACACCTCCCAGTAGG - Intronic
947275786 2:228390672-228390694 ACTGGGAAACACCTCCTAGTAGG - Intergenic
947494047 2:230619971-230619993 ACTGGGGAACACCTCCCAGTAGG + Intergenic
947902812 2:233736955-233736977 ACTGGGAAACACCTCCCAGTAGG - Intronic
948328239 2:237143582-237143604 ACTAGACCCCACATCCCATTGGG + Intergenic
1169176710 20:3522616-3522638 ACTAGGAGACACCTCCCATCAGG + Intronic
1169659022 20:7957943-7957965 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1170229223 20:14027000-14027022 ACTAGGTGACACCTCCCAGCAGG + Intronic
1170229319 20:14027852-14027874 ACTAGGTGACACCTCCCAGCCGG - Intronic
1170543439 20:17411743-17411765 ACTAGGAGACACCTCCCAGTAGG + Intronic
1171050541 20:21854142-21854164 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1171247134 20:23620748-23620770 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1171273689 20:23836157-23836179 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1171514716 20:25720144-25720166 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1172178824 20:32988335-32988357 ACCAGGCAGCACCTCCAACTCGG - Intronic
1172456239 20:35076671-35076693 ACTGGGAGACACCTCCCAGTAGG - Intronic
1172466951 20:35162265-35162287 ACTGGGAGACACCTCCCATAGGG + Intergenic
1173543802 20:43876544-43876566 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1173932984 20:46837379-46837401 TCTAGTTAACATCTCCCATTGGG - Intergenic
1174694552 20:52543656-52543678 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1174771052 20:53300859-53300881 AATATGCAACACCTTCCACTGGG - Intronic
1175464799 20:59183271-59183293 ACTTGCCAGCACCTCCCTTTGGG + Intergenic
1176065826 20:63194065-63194087 TCTAGACAACACCTCCCCTGAGG - Intergenic
1178864371 21:36316112-36316134 ACTAGGAGACACCTCCCACCAGG - Intergenic
1179574745 21:42301121-42301143 ACTGGGCCACACCTTCCCTTTGG + Intergenic
1180541068 22:16447917-16447939 ACTGGGACACACCTCCCAGTAGG + Intergenic
1180640945 22:17299048-17299070 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1181326912 22:22057007-22057029 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1182197091 22:28529637-28529659 ACTGGGAGACACCTCCCAGTAGG + Intronic
949245207 3:1918921-1918943 ACTGGGAGACACCTCCCAGTAGG - Intergenic
949423462 3:3891061-3891083 ACTAGGAGACACCTCCCAGTAGG - Intronic
949450082 3:4175260-4175282 ACTGGGAGACACCTCCCAGTTGG + Intronic
949453387 3:4212130-4212152 ACTGGGAGACACCTCCCAGTAGG + Intronic
949456579 3:4245657-4245679 ACTGGGAGACACCTCCCAGTAGG - Intronic
949532142 3:4966456-4966478 ACTGGGAGACACCTCCCAGTAGG + Intergenic
950299831 3:11867417-11867439 ACTGGGAGACACCTCCCAGTAGG - Intergenic
950792585 3:15485306-15485328 ACTGGGAGACACCTCCCAGTAGG - Intronic
951389275 3:22082780-22082802 ACTGGGAGACACCTCCCAGTAGG + Intronic
951439471 3:22706804-22706826 ACTTGGAGACACCTCCCAGTAGG - Intergenic
951471598 3:23062448-23062470 ACTGGGTGACACCTCCCAGTAGG - Intergenic
951747793 3:25998841-25998863 ACTGGGAGACACCTCCCAGTAGG - Intergenic
952527778 3:34230243-34230265 ACTTTGCAGCATCTCCCATTAGG - Intergenic
952813935 3:37430777-37430799 ACTGGGAGACACCTCCCAGTAGG - Intronic
952864063 3:37839532-37839554 ACTGGGAGACACCTCCCAGTAGG + Intergenic
953112278 3:39954243-39954265 ACTGGGAGACACCTCCCAGTAGG + Intronic
953219004 3:40950682-40950704 ACTGGGAGACACCTCCCAGTAGG - Intergenic
953232316 3:41075961-41075983 ACGAGGCAACCCCTCCCTCTTGG - Intergenic
953256357 3:41294141-41294163 CCTAAACATCACCTCCCATTAGG - Intronic
954490550 3:50900914-50900936 ACTAGGAGACACCTCCCAACAGG - Intronic
954500943 3:51013587-51013609 ACTTGGAGACACCTCCCAATAGG - Intronic
954513807 3:51152916-51152938 ACTGGGAGACACCTCCCAGTAGG - Intronic
954836453 3:53473359-53473381 ACTGGGAGACACCTCCCAGTAGG - Intergenic
955172564 3:56581822-56581844 ACTGGGAGACACCTCCCAGTAGG - Intronic
955361610 3:58281013-58281035 ACTGGGAGACACCTCCCAGTAGG - Intronic
955420066 3:58727081-58727103 ACTTGGCTCCACCTCCCATAGGG + Intronic
955464860 3:59226269-59226291 ACTGGGAGACACCTCCCAGTAGG - Intergenic
955667377 3:61364718-61364740 ACTGGGAGACACCTCCCAGTAGG + Intergenic
956242059 3:67141855-67141877 ACTAGGAGACACCTCCCAGCAGG - Intergenic
956316955 3:67948523-67948545 ACTAGGAAACACCTCCCAGTAGG + Intergenic
956373198 3:68586558-68586580 ACTGGGAGACACCTCCCAGTAGG - Intergenic
956396566 3:68832601-68832623 ACTGGGAGACACCTCCCAATAGG - Intronic
956993346 3:74794797-74794819 ACTTGGAGACACCTCCCAGTAGG + Intergenic
957285297 3:78209956-78209978 ACGATCCAACACCTCCCATTGGG - Intergenic
957643525 3:82888474-82888496 ATTAGTCCCCACCTCCCATTGGG + Intergenic
957776565 3:84761712-84761734 ACTGGGCAACACCTCCCAGCAGG + Intergenic
957811520 3:85228761-85228783 GCTAGGAGACACCTCCCAGTAGG - Intronic
957917803 3:86708780-86708802 ACTGGGAAACCCCTCCCAGTAGG - Intergenic
958021697 3:88005397-88005419 ATTAAGCAACTCCTCCCATACGG - Intergenic
958037042 3:88182649-88182671 ACTGGGAGACACCTCCCAGTAGG + Intergenic
958191702 3:90193037-90193059 ACTGGGAGACACCTCCCAGTAGG - Intergenic
958413916 3:93852199-93852221 ACTGGGAGACACCTCCCAGTAGG - Intergenic
958434453 3:94080348-94080370 ACTGGGACACACCTCCCAGTAGG - Intronic
958479781 3:94631323-94631345 ACTTGGAGACACCTCCCAGTAGG + Intergenic
958622151 3:96575710-96575732 ACTGGGAGACACCTCCCAGTAGG - Intergenic
959045346 3:101467410-101467432 ACTGGGAGACGCCTCCCATTAGG + Intronic
959052771 3:101540592-101540614 ACTGGGAGGCACCTCCCATTAGG - Intergenic
959091739 3:101910904-101910926 ACTGGGAGACACCTCCCAGTAGG - Intergenic
959170783 3:102841680-102841702 ACTGGGAGACACCTCCCAGTAGG - Intergenic
959815874 3:110672258-110672280 ACTGGGAAACACCTCCCAGCAGG + Intergenic
959940103 3:112072385-112072407 ACTGGGAGACACCTCCCAGTAGG - Intronic
960478855 3:118163333-118163355 ACTGGGAGACACCTCCCAGTAGG + Intergenic
960508142 3:118517447-118517469 ACTGGGAGACACCTCCCAGTAGG + Intergenic
960832312 3:121863103-121863125 ACTGGGAGACACCTCCCAGTAGG - Intronic
960911305 3:122651662-122651684 ACTGGGAGACACCTCCCAGTAGG + Intergenic
961310657 3:125997275-125997297 ACTAGGAGACACCTCCCAGTAGG + Intergenic
962137076 3:132746589-132746611 ACTGGGAGACACCTCCCAGTAGG - Intergenic
962291500 3:134140589-134140611 ACTGGGAGACACCTCCCAGTAGG + Intronic
962512413 3:136114967-136114989 ACTGGGAGACACCTCCCAGTAGG + Intronic
962602753 3:137007205-137007227 ACTGGGAGACACCTCCCAGTAGG - Intronic
962767020 3:138574670-138574692 ACTGGGAGACACCTCCCAGTAGG + Intronic
962907570 3:139818645-139818667 ACTGGGAGACACCTCCCAGTAGG - Intergenic
962914041 3:139882856-139882878 ACTAGGAGACACCTCCCAGTAGG - Intergenic
963159928 3:142140801-142140823 ACTGGGAGACACCTCCCAGTAGG - Intronic
963306907 3:143663017-143663039 ACTGGGAGACACCTCCCAGTAGG + Intronic
963514641 3:146293310-146293332 ACTGGGAGACACCTCCCAGTAGG - Intergenic
963531569 3:146477811-146477833 ACTGGGAGACACCTCCCAGTAGG + Intronic
963689301 3:148478594-148478616 ACTGGGAGACACCTCCCAGTAGG + Intergenic
963976386 3:151484500-151484522 ACTGGGAGACACCTCCCAGTAGG + Intergenic
963980318 3:151529407-151529429 ACTGGGAGACACCTCCCATTAGG + Intergenic
964995057 3:162868502-162868524 ACTGGGAGACACCTCCCAGTAGG + Intergenic
965091004 3:164162861-164162883 ACTGGGTAACACCTCCCAGCAGG - Intergenic
965161552 3:165139786-165139808 ACTGGGAGACACCTCCCAGTAGG - Intergenic
965221453 3:165931800-165931822 ACTGGGAGACACCTCCCAGTAGG + Intergenic
965281693 3:166763482-166763504 AATAGGGAACACTGCCCATTCGG + Intergenic
966150444 3:176862009-176862031 ACTGGGAGACACCTCCCACTAGG + Intergenic
966454835 3:180102795-180102817 ATTGGGCAATACCTCCCAATAGG + Intergenic
966494173 3:180560637-180560659 ACTGGGAGACACCTCCCAGTAGG + Intergenic
967248548 3:187513420-187513442 ACTGGGAGACACCTCCCAGTAGG + Intergenic
967569838 3:191015853-191015875 ACTGGGAGACACCTCCCAGTAGG - Intergenic
967638683 3:191835149-191835171 ACTAGGGGACACCTCCCAGTAGG + Intergenic
967756908 3:193180090-193180112 ACTGGGAGACACCTCCCAGTAGG + Intergenic
968358962 3:198133353-198133375 ACTGGGCAAGACCTCCCAACAGG - Intergenic
968860594 4:3166337-3166359 ACTGGGAGACACCTCCCAGTAGG - Intronic
970182882 4:13417468-13417490 ACTGGGAGACACCTCCCAGTAGG + Intronic
970864145 4:20739314-20739336 ACTGGGAAACACCTCCTAGTAGG + Intronic
970975685 4:22040603-22040625 ACTAGGAGACACCTCCCAGTAGG - Intergenic
971560803 4:28077658-28077680 ACTTGGAGACACCTCCCAGTAGG + Intergenic
972196226 4:36656728-36656750 ACTGGGAGACACCTCCCAGTAGG + Intergenic
972685662 4:41350163-41350185 ACTGGGAGACACCTCCCAGTAGG + Intergenic
972972429 4:44593815-44593837 ACTGGGAGACACCTCCCAGTAGG + Intergenic
973154410 4:46932057-46932079 CCTTGGCAGCACCTCCCATCAGG - Intronic
973341789 4:49012908-49012930 ACTGGGAGACACCTCCCAGTAGG - Intronic
973569625 4:52224732-52224754 ACTGGGAGACACCTCCCAGTAGG - Intergenic
973599026 4:52522574-52522596 ACTGGGAGACACCTCCCAGTAGG + Intergenic
973626015 4:52773571-52773593 ACTGGGAGACACCTCCCAGTAGG - Intergenic
973871296 4:55169525-55169547 ACTGGGAAACACCTACCAGTAGG - Intergenic
973883592 4:55297854-55297876 ACTGGGAAACACCTCCCAGTAGG + Intergenic
974006413 4:56561665-56561687 ATGACCCAACACCTCCCATTAGG + Intronic
974106173 4:57472313-57472335 ACTGGGAGACACCTCCCATTAGG - Intergenic
974127573 4:57714820-57714842 ACTTGGAGACACCTCCCAGTAGG + Intergenic
974161822 4:58150242-58150264 ACTAGGAGACACCTCCCAGTAGG + Intergenic
974196718 4:58585008-58585030 ACTGGGAGACACCTCCCAGTAGG - Intergenic
974263909 4:59560044-59560066 ACTGGGAGACACCTCCCAGTAGG - Intergenic
974265685 4:59583678-59583700 ACTGGGAGACACCTCCCAGTAGG - Intergenic
974276219 4:59724162-59724184 ACTGGGAGACACCTCCCAGTAGG - Intergenic
974280093 4:59780834-59780856 ACTGGGAGACACCTCCCAGTAGG + Intergenic
974491557 4:62571365-62571387 ACTGGGAGACACCTCCCAGTAGG - Intergenic
974719940 4:65725399-65725421 ACTGGGAGACACCTCCCAGTAGG + Intergenic
974774539 4:66462757-66462779 ACTGGGAGACACCTCCCAGTAGG - Intergenic
974793073 4:66714596-66714618 ACTGGGAATCACCTCCCAGTAGG + Intergenic
974871800 4:67653254-67653276 ACTGGGAAACACCTCCCAGTAGG + Intronic
974874403 4:67685640-67685662 ACTAGGCAACACCTCCCATTAGG - Intronic
975235931 4:71996750-71996772 ACTAGGAGTCACCTCCCAGTAGG + Intergenic
975305728 4:72846936-72846958 ACTGGGAGACACCTCCCAGTAGG + Intergenic
975500505 4:75079668-75079690 ACTGGGAGACACCTCCCAGTAGG - Intergenic
975520943 4:75300399-75300421 ACTGGGAGACACCTCCCAGTAGG - Intergenic
975522364 4:75314149-75314171 ACTGGGAGACACCTCCCAGTAGG + Intergenic
975638859 4:76478679-76478701 ACTGGGAGACACCTCCCAGTAGG + Intronic
975729802 4:77327025-77327047 ACTGGGAGACACCTCCCAGTAGG - Intronic
976092784 4:81474373-81474395 ACTGGGGGACACCTCCCAGTAGG + Intronic
976167679 4:82272472-82272494 ACTGGGGGACACCTCCCAGTAGG + Intergenic
976438368 4:85044348-85044370 ACTGGGAGACACCTCCCAGTAGG + Intergenic
976445905 4:85129563-85129585 ACTGGGAGACACCTCCCAGTAGG - Intergenic
976477893 4:85506160-85506182 ACTGGGAGACACCTCCCAGTAGG - Intronic
976552528 4:86413324-86413346 ACTAGGAGAAACCTCCCAGTAGG - Intronic
976760127 4:88539640-88539662 ACTGGGAGACACCTCCCAGTAGG + Intronic
976790309 4:88870849-88870871 ACTGGGAGACACCTCCCAGTAGG + Intronic
976968720 4:91078175-91078197 AATAGGAGACACCTCCCAGTAGG + Intronic
977326425 4:95580205-95580227 ACTGGGAAACACCTCCCAGTAGG - Intergenic
977425612 4:96863564-96863586 ACTAGGAGACACCTCCCAGGAGG + Intergenic
977630644 4:99239025-99239047 ACTGGGAGACACCTCCCAGTAGG - Intergenic
977631407 4:99247647-99247669 ACTAGGAGACACCTCCCAGCAGG - Intergenic
977671462 4:99699771-99699793 ACTGGGAGACACCTCCCATCAGG + Intergenic
977829768 4:101576777-101576799 ACTGGGAGACACCTCCCAGTAGG + Intronic
977906040 4:102478616-102478638 ACTGGGAGACACCTCCCAGTAGG + Intergenic
978020883 4:103810255-103810277 ACTGGGAGACACCTCCCAGTAGG - Intergenic
978188045 4:105880880-105880902 ACTGGGAGACACCTCCCAGTAGG + Intronic
978517742 4:109586874-109586896 ACTGGGAGACACCTCCCAGTAGG - Intronic
978928993 4:114287734-114287756 ACTGGGAGACACCTCCCAGTAGG + Intergenic
978968705 4:114775141-114775163 ATGACACAACACCTCCCATTAGG - Intergenic
979017415 4:115452129-115452151 ACTGGGAGACACCTCCCAGTAGG - Intergenic
979288022 4:118948800-118948822 ACTAGGCCCCACCTCCAGTTGGG + Intronic
979315327 4:119255143-119255165 ACTGGGAGACACCTCCCATTAGG - Intronic
979326515 4:119386084-119386106 ACTGGGAGACACCTCCCAGTAGG - Intergenic
979487553 4:121285496-121285518 ACTGGGAGACACCTCCCAGTAGG + Intergenic
979510643 4:121550098-121550120 ACTGGGAGACACCTCCCAGTAGG - Intergenic
979581434 4:122365524-122365546 ACTGGGAGACACCTCCCAGTAGG + Intergenic
979750637 4:124274804-124274826 ACTGGGAGACACCTCCCAGTAGG - Intergenic
979954936 4:126940776-126940798 ACTGGGGGACACCTGCCATTGGG - Intergenic
979998635 4:127463590-127463612 ACTGGGAGACACCTCCCAGTAGG - Intergenic
980037768 4:127904913-127904935 ACTGGGAGACACCTCCCAGTAGG - Intergenic
980196058 4:129590440-129590462 ACTGGGGGACACCTCCCAGTAGG - Intergenic
980503919 4:133690602-133690624 ACTGGGAGACACCTCCCAGTAGG - Intergenic
981208006 4:142067056-142067078 ACTGGGAGACACCTCCCAGTAGG + Intronic
981411323 4:144435630-144435652 ACTGGGAGACACCTCCCAGTAGG + Intergenic
981415048 4:144483153-144483175 ACTGGGAGACACCTCCCAGTAGG + Intergenic
981560897 4:146047717-146047739 ACTGGGAGACACCTCCCAGTAGG - Intergenic
981655976 4:147112651-147112673 ACTGGGAGACACCTCCCAGTAGG + Intergenic
981846587 4:149176541-149176563 ACTAGGAGACACATCCCAGTAGG + Intergenic
981859781 4:149340974-149340996 ACTGGGAGACACCTCCCAGTAGG - Intergenic
981869464 4:149468708-149468730 ACTGGGAAACACCTCCCAGTAGG + Intergenic
982725528 4:158902424-158902446 ACTGGGAGACACCTCCCAGTAGG - Intronic
983182769 4:164668093-164668115 ACTGGGAGACACCTCCCAGTAGG + Intergenic
983183601 4:164676609-164676631 ACTGGGAGACACCTCCCAGTAGG + Intergenic
983244384 4:165270739-165270761 ACTGGGAGACACCTCCCAGTAGG - Intronic
983334473 4:166374689-166374711 ACTTGGAGACACCTCCCAGTAGG - Intergenic
983486983 4:168343802-168343824 ACTGGGAGACACCTCCCAGTAGG - Intergenic
983668356 4:170207805-170207827 ACTGGGAGACACCTCCCAGTAGG + Intergenic
983677857 4:170317112-170317134 ACTGGGAGACACCTCCCAGTAGG + Intergenic
983788121 4:171759761-171759783 ACTTGGAGACACCTCCCAGTAGG + Intergenic
983879119 4:172912948-172912970 ACTGGGAGACACCTCCCAGTAGG + Intronic
983949043 4:173618652-173618674 ACTGGGAGACACCTCCCAGTAGG - Intergenic
984224480 4:177017914-177017936 ACTGGGAGACACCTCCCAGTAGG + Intergenic
984372467 4:178884634-178884656 ACTGGGAAACACCTACCAGTAGG + Intergenic
985794824 5:1954138-1954160 ACTGGGAGACACCTCCCAGTAGG + Intergenic
986127043 5:4892989-4893011 ACTGGGAGACACCTCCCAGTAGG - Intergenic
986838766 5:11672221-11672243 ACTGGGAGACACCTCCCAGTAGG - Intronic
986839159 5:11676041-11676063 ACTGGGAGACACCTCCCAGTAGG + Intronic
986877227 5:12126356-12126378 ACTGGGAGACACCTCCCAGTAGG + Intergenic
987179949 5:15356795-15356817 ACTGGGAGACACCTCCCAGTAGG + Intergenic
987704545 5:21446439-21446461 ACTAGGAGACACCTCCCAGAAGG - Intergenic
987949756 5:24660159-24660181 ACTTGGAGACACCTCCCAGTAGG - Intergenic
988187788 5:27889308-27889330 ACTTGGAGACACCTCCCAGTAGG - Intergenic
988618288 5:32795709-32795731 ACTGGGAGACACCTCCCAGTAGG + Intergenic
988627958 5:32898321-32898343 ACTGGGAAACACCTCCCAGGAGG - Intergenic
988719278 5:33859710-33859732 ACTGGGAAACACCTCCCAGCAGG + Intronic
988771082 5:34434197-34434219 ACTGGGAGACACCTCCCAGTAGG - Intergenic
988772516 5:34447230-34447252 ACTGAGAAACACCTCCCAGTAGG - Intergenic
988840204 5:35075771-35075793 ACTAGGAGACACTTCCCAGTAGG + Intronic
988843415 5:35104953-35104975 ACTAGGAGACACTTCCCAGTAGG + Intronic
988867638 5:35353494-35353516 ACTAGGAGACACCTCCCAGCAGG - Intergenic
989087322 5:37689413-37689435 ACTGGGAGACACCTCCCAGTAGG + Intronic
989345241 5:40422626-40422648 ACTGGGAGACACCTCCCAGTAGG - Intergenic
989358027 5:40566806-40566828 ACTGGGAAACACCTCCCAATAGG - Intergenic
989390580 5:40896072-40896094 ACTGGGAGACACCTCCCAGTAGG + Intergenic
989522415 5:42417837-42417859 ACTGGGAGACACCTCCCAGTAGG - Intergenic
989562066 5:42863538-42863560 ACTGGGAGACACCTCCCAGTAGG + Intronic
989583327 5:43053836-43053858 ACTGGGAGACACCTCCCAGTAGG + Intergenic
989614688 5:43328289-43328311 ACTGGGAGACACCTCCCAGTAGG - Intergenic
989682610 5:44046783-44046805 ACTAGGCAAGGCCTCCCTGTGGG - Intergenic
990234376 5:53751200-53751222 ACTGGGAGACACCTCCCAGTAGG + Intergenic
990713155 5:58606620-58606642 ACTGGGAGACACCTCCCAGTAGG + Intronic
990870043 5:60421262-60421284 ACTGGGAGACACCTCCCAGTAGG + Intronic
991026600 5:62037086-62037108 ACTGGGAGACACCTCCCAGTAGG - Intergenic
991105511 5:62837821-62837843 ACTGGGAGACACCTCCCAGTAGG + Intergenic
991364242 5:65852329-65852351 ACTGGGAGACACCTCCCAGTAGG - Intronic
991387567 5:66106650-66106672 ACTTGGAGACACCTCCCATTAGG + Intergenic
991575896 5:68102928-68102950 ACTGGGAGACACCTCCCAGTAGG + Intergenic
992031769 5:72728325-72728347 ACTGGGAGACACCTCCCAGTAGG + Intergenic
992277166 5:75131743-75131765 ACTAGGAGGCACCTCCCATTAGG + Intronic
992506003 5:77388511-77388533 ACTGGGAGACACCTCCCAGTAGG - Intronic
992516754 5:77501604-77501626 ACTGGGAGACACCTCCCAGTAGG + Intronic
992580885 5:78174641-78174663 ACTGGGAGACACCTCCCACTAGG - Intronic
992854456 5:80846321-80846343 ACTGGGAGACACCTCCCAGTAGG - Intronic
992908776 5:81374038-81374060 ACTGGGAGACACCTCCCAGTAGG + Intronic
992973187 5:82083564-82083586 ACTGGGAGACACCTCCCAGTAGG + Intronic
993044048 5:82847463-82847485 ACTGGGAGACACCTCCCAATAGG - Intergenic
993470916 5:88306445-88306467 ACTGGGAGACACCTCCCAGTAGG + Intergenic
993656279 5:90581661-90581683 ACTGGGAGACACCTCCCAGTAGG - Intronic
993888341 5:93442774-93442796 ACTGGGAGACACCTCCCAGTAGG + Intergenic
994039717 5:95244899-95244921 ACTGGGAAACCCCTCCCAGTAGG + Intronic
994137889 5:96308896-96308918 ACTGGGAAACACCTCTCAGTAGG - Intergenic
994160384 5:96550134-96550156 ACTGGGAGACACCTCCCAGTAGG + Intronic
994609595 5:102019272-102019294 ACTGGGAGACATCTCCCATTAGG + Intergenic
994861238 5:105198594-105198616 ACTGGGAGACACCTCCCATTAGG + Intergenic
995093852 5:108212753-108212775 ACTGGGAGACACCTCCCACTAGG - Intronic
995108272 5:108399479-108399501 ACTGGGAGACACCTCCCACTAGG + Intergenic
995136503 5:108685553-108685575 ACTGGGAGACACCTCCCAGTAGG - Intergenic
995215902 5:109594109-109594131 ACTAGACAGCACCTACCATGGGG - Intergenic
995459809 5:112390775-112390797 ACTGGGAGACACCTCCCAGTAGG + Intronic
995528992 5:113074113-113074135 ACTGGGAGACACCTCCCAGTAGG + Intronic
995695811 5:114876920-114876942 ACTGGGAGACACCTCCCAGTAGG + Intergenic
996147243 5:119991553-119991575 ACTGGGAGACACCTCCCAGTAGG - Intergenic
996275443 5:121660605-121660627 ACTAGGAGACACCTCCAAGTAGG + Intergenic
996953231 5:129152917-129152939 ACTAGGAGACACCTCCCAGCAGG - Intergenic
997004759 5:129804550-129804572 ACTGGGCAACACCTCCCAGTAGG - Intergenic
997115549 5:131122581-131122603 ACTGGGAGACACCTCCCAGTAGG - Intergenic
997496978 5:134336745-134336767 ACTGGGCGACACCTCCCAGTAGG - Intronic
998780076 5:145646957-145646979 ACTGGGAGACACCTCCCAGTGGG - Intronic
999944564 5:156581336-156581358 ACTGGGAGACACCTCCCAGTAGG - Intronic
999963553 5:156783535-156783557 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1000069025 5:157721645-157721667 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1000145128 5:158446626-158446648 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1000591664 5:163165748-163165770 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1000746968 5:165045853-165045875 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1001009183 5:168082860-168082882 ACTGGGAGACACCTCCCAGTAGG - Intronic
1001025052 5:168216948-168216970 ACTAAGCAACACCTGCCCCTTGG + Intronic
1001347749 5:170922247-170922269 ACTGGGAAACACCTCCCAGTAGG - Intronic
1001792121 5:174466628-174466650 ACTAGTGGACACCTCCCAGTAGG + Intergenic
1002734737 5:181377003-181377025 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1002749791 6:97117-97139 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1002804154 6:556158-556180 AGTAAGGAACACCTCCCAGTAGG - Intronic
1003316747 6:5019969-5019991 ACTGGGAGACACCTCCCAATAGG - Intergenic
1003496616 6:6668863-6668885 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1003542207 6:7027563-7027585 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1003831934 6:10021358-10021380 ACTGGAAAACACCTCCCAGTAGG - Intronic
1003971059 6:11299582-11299604 ACTGGGAAACACTTCCCAGTAGG + Intronic
1004056105 6:12140065-12140087 ACTAGGAGACACCTCCCCGTAGG + Intronic
1004717216 6:18228984-18229006 ACTGGGAGACACCTCCCAGTAGG + Intronic
1004831597 6:19482458-19482480 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1005558194 6:27009115-27009137 ACTGGGAAACACCTCCCACTAGG + Intergenic
1005747193 6:28849147-28849169 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1005936032 6:30521526-30521548 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1006812369 6:36828146-36828168 ACAGGGTAACACCTCCCATCTGG + Intronic
1006817043 6:36858668-36858690 ACTAGGGGAAACCTCCCACTTGG + Intronic
1007134643 6:39508952-39508974 ACTGGGAGACACCTCCCAGTAGG + Intronic
1007461357 6:42021579-42021601 ACTAGGAAACACCACCCAGGAGG + Intronic
1008529963 6:52447979-52448001 ACTGGGAGACACCTCCCAGTAGG - Intronic
1008575392 6:52855990-52856012 ACTGGGAGACACCTCCCAGTAGG - Intronic
1008782666 6:55126541-55126563 ACTGGGAGACACCTCCCAGTAGG - Intronic
1009361329 6:62818197-62818219 ATTGGGAAACACCTCCCAGTAGG - Intergenic
1009393308 6:63167682-63167704 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1009410822 6:63362928-63362950 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1009453658 6:63829796-63829818 ACTGGGAGACACCTCCCAGTAGG + Intronic
1009492787 6:64312581-64312603 ACTAGGAGACATCTCCCAGTAGG + Intronic
1010003926 6:70974852-70974874 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1010006306 6:70998716-70998738 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1010297977 6:74222718-74222740 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1010364296 6:75031551-75031573 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1010422090 6:75687815-75687837 ACTGGGAGACACCTCCCAGTAGG - Intronic
1010475624 6:76283263-76283285 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1010667125 6:78643883-78643905 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1010682982 6:78818241-78818263 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1010727077 6:79347461-79347483 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1010755628 6:79663583-79663605 ACTGGGAGACACCTCCCAGTAGG - Intronic
1010820622 6:80411380-80411402 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1010837952 6:80612828-80612850 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1010961569 6:82151621-82151643 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1011062939 6:83292539-83292561 ACTGGGAGACACCTCCCAGTAGG - Intronic
1011086557 6:83547170-83547192 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1011139069 6:84133268-84133290 ACTGGGAGACACCTCCCAATAGG - Intronic
1011245122 6:85314405-85314427 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1011288659 6:85752358-85752380 ACTGGGAAACACTTCCCAGTAGG + Intergenic
1011292049 6:85787525-85787547 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1011304153 6:85908443-85908465 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1011336924 6:86271937-86271959 ACTAGGAGACATCTCCCAGTAGG - Intergenic
1011417800 6:87140387-87140409 ACTGGGCAACACCTCCCAGTAGG + Intergenic
1011524970 6:88254316-88254338 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1011766325 6:90623807-90623829 ACTAGGAGACACCTCCCAGCAGG + Intergenic
1011848047 6:91590666-91590688 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1012532218 6:100251643-100251665 ATTAGGCCTTACCTCCCATTAGG - Intergenic
1012590030 6:100969401-100969423 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1012799098 6:103802555-103802577 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1012881875 6:104800442-104800464 ACTAGGAGACACCTCCTAGTAGG + Intronic
1013320169 6:108980430-108980452 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1013387455 6:109645786-109645808 ACTTGGAGACACCTCCCAGTAGG + Intronic
1013436685 6:110116752-110116774 ACTGGGGAACACCTCCCAGTAGG + Intronic
1013883045 6:114928622-114928644 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1014122880 6:117746305-117746327 ACTGGGAAACACCTCCCAGCAGG + Intergenic
1014352598 6:120363203-120363225 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1014918392 6:127182223-127182245 ACTCCCAAACACCTCCCATTTGG + Intronic
1015046961 6:128787754-128787776 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1015133079 6:129836139-129836161 ACTGGGAAACACCTCCCAGTAGG + Intronic
1015893187 6:137989564-137989586 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1016102112 6:140115426-140115448 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1016265957 6:142232874-142232896 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1016418321 6:143856873-143856895 CCTAGGAGACACCTCCCATCAGG - Intronic
1016436822 6:144046606-144046628 ACTGGGAGACACCTCCCAGTAGG - Intronic
1016523829 6:144977138-144977160 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1016655594 6:146515098-146515120 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1016985833 6:149895198-149895220 ACTGGGAGACACCTCCCAGTAGG - Intronic
1017231634 6:152079210-152079232 ACTGGGAGACACCTCCCAGTAGG + Intronic
1017279686 6:152609699-152609721 ACTGGGATACACCTCCCAGTAGG + Intronic
1017356955 6:153520908-153520930 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1017836467 6:158183298-158183320 ACTGGGAGACACCTCCCAGTAGG - Intronic
1018114023 6:160565256-160565278 ACTGGGGGACACCTCCCAGTAGG + Intronic
1018175739 6:161178058-161178080 ACTGGGAGACACCTCCCAGTAGG - Intronic
1018595161 6:165471473-165471495 ACTACTTAACATCTCCCATTTGG + Intronic
1018724806 6:166603625-166603647 CCTGGGCAACACCTGTCATTGGG + Intronic
1018760022 6:166885542-166885564 ACTGGGAGACACCTCCCAGTAGG + Intronic
1019238995 6:170649323-170649345 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1019710452 7:2516015-2516037 ACTAGGCCACGCCTGCCTTTTGG + Intronic
1020349360 7:7201411-7201433 ACTGGGAGACACCTCCCAGTAGG - Intronic
1020443139 7:8240120-8240142 ACTGGGAGACACCTCCCAGTAGG + Intronic
1020693753 7:11391035-11391057 ACTGGGAGACACCTCCCAGTAGG - Intronic
1020774091 7:12431766-12431788 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1020810039 7:12840230-12840252 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1020818746 7:12939514-12939536 ACTGGGAAACACCTCCCAGAAGG - Intergenic
1020833989 7:13126253-13126275 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1021201787 7:17735416-17735438 ACTGGGAGACATCTCCCATTAGG + Intergenic
1021207938 7:17807666-17807688 ACTGGGAGACACCTCCCATCAGG + Intronic
1021306580 7:19039664-19039686 ACTGGGAGACACCTCCCAGTAGG - Intronic
1021379840 7:19954116-19954138 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1021755274 7:23845248-23845270 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1021782237 7:24117765-24117787 ACTAGGAAATATCTCCCAGTAGG - Intergenic
1022187335 7:27982684-27982706 ACTGGGAGACACCTCCCAGTAGG + Intronic
1022453640 7:30538199-30538221 ACTGGGAAACACCTCCCAGTAGG + Intronic
1022465229 7:30649064-30649086 TCTAGGGAAGAACTCCCATTGGG + Intergenic
1022867043 7:34432030-34432052 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1023066002 7:36378514-36378536 ACTAGGAGACATCTCCCAGTAGG - Intronic
1023146282 7:37153882-37153904 ACTAGAAGACACCTCCCAGTAGG + Intronic
1023509348 7:40934357-40934379 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1023848233 7:44135396-44135418 GCCAGGCAACAGCTCCCAGTTGG - Intergenic
1024091418 7:45944714-45944736 ACTAGAAAACACCTCCTTTTAGG + Intergenic
1024106105 7:46088350-46088372 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1024130025 7:46341739-46341761 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1024591330 7:50887558-50887580 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1025147849 7:56520410-56520432 ACAAGGCAACAGCTCCTTTTTGG - Intergenic
1025787954 7:64660607-64660629 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1027445997 7:78274377-78274399 ACTGGGAGACACCTCCCAGTAGG - Intronic
1027493609 7:78860652-78860674 ACTGGGAGACACCTCCCAGTAGG - Intronic
1027510282 7:79071388-79071410 ACTAGGAGACACCTCCCAGCAGG - Intronic
1027790465 7:82634080-82634102 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1028004288 7:85542584-85542606 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1028050111 7:86174647-86174669 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1028080374 7:86567878-86567900 ACTAGGAGACACCTCCCACCAGG + Intergenic
1028139991 7:87263262-87263284 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1028395977 7:90369213-90369235 ACTGGGAGACACCTCCCAGTAGG - Intronic
1028446384 7:90928630-90928652 ACTGGGAGACACCTCCCAGTAGG - Intronic
1028523706 7:91759781-91759803 ACTGGGAGACACCTCCCAGTAGG + Intronic
1028578530 7:92380461-92380483 ACTTGGAGACACCTCCCATTAGG + Intronic
1028836189 7:95377497-95377519 ACTGGGAGACACCTCCCAGTAGG + Intronic
1029006471 7:97215453-97215475 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1029810110 7:103038540-103038562 ACTGGGAAACATCTCCCAGTAGG + Intronic
1029845185 7:103405623-103405645 ACTGGGAGACACCTCCCAGTAGG - Intronic
1030166361 7:106559849-106559871 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1030181122 7:106710109-106710131 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1030202522 7:106919514-106919536 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1030220974 7:107098924-107098946 ACTGGGAGACACCTCCCAGTAGG - Intronic
1030526433 7:110660525-110660547 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1030534100 7:110744448-110744470 ACTAGGAGACACCTCCCAGTAGG + Intronic
1031157126 7:118122924-118122946 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1031434226 7:121712883-121712905 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1031803621 7:126279482-126279504 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1031905096 7:127451661-127451683 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1032250641 7:130254460-130254482 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1032312512 7:130801967-130801989 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1032603987 7:133329864-133329886 ACTAGGAGACACCTCCCAGTAGG - Intronic
1032883387 7:136114269-136114291 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1033679522 7:143580364-143580386 ACTAGGAGACACCTCCCATTAGG - Intergenic
1033692314 7:143749079-143749101 ACTAGGAGACACCTCCCATTAGG + Intergenic
1033834530 7:145293142-145293164 ACTATGCAGCACCTCCCAACTGG - Intergenic
1033863445 7:145659278-145659300 ACTGGGAGACACCTCCCAATAGG + Intergenic
1033902314 7:146157968-146157990 ACTAGGAGACACCTCCCAGTAGG + Intronic
1034097747 7:148425409-148425431 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1034394246 7:150808256-150808278 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1034689078 7:152999667-152999689 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1035508775 8:157286-157308 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1035558780 8:589477-589499 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1036551270 8:9816655-9816677 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1037050089 8:14362102-14362124 ACTGGGAGACACCTCCCAGTAGG - Intronic
1037249857 8:16879002-16879024 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1037557590 8:20040733-20040755 ACTGGGAGACACCTCCCATTAGG - Intergenic
1038221682 8:25614766-25614788 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1038317975 8:26503589-26503611 ACTAGGCCACCCCTCCTCTTGGG - Intronic
1038873254 8:31519552-31519574 ACTGGGTGACACCTCCCAGTAGG - Intergenic
1039103611 8:33967125-33967147 ACTGGGAGACACCACCCATTAGG - Intergenic
1039634006 8:39143628-39143650 ACTGGGAAACACCTCCCAGTAGG - Intronic
1039832423 8:41225697-41225719 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1040383410 8:46894666-46894688 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1040451667 8:47554158-47554180 ACTGGGAGACACCTCCCAGTAGG - Intronic
1040473106 8:47752661-47752683 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1040556748 8:48486265-48486287 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1040712808 8:50209454-50209476 ACTGGGAGACACCTCCCAGTAGG + Intronic
1040942973 8:52852111-52852133 ACTAGGAGACACCTCCCAGTAGG - Intergenic
1041217632 8:55616439-55616461 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1041221592 8:55656851-55656873 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1041349920 8:56938003-56938025 ACTGGGAAACGCCTCCCAGTAGG + Intergenic
1041423623 8:57695877-57695899 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1041630501 8:60082374-60082396 ACTAGGAGACACCTCCCAGCAGG - Intergenic
1041909912 8:63077888-63077910 ACTGGGAGACACCTCCCAGTAGG + Intronic
1041951650 8:63510168-63510190 ACTAGGAAACATCTCCCAGTAGG - Intergenic
1041997757 8:64084379-64084401 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1042070736 8:64930859-64930881 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1042195653 8:66229233-66229255 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1042597464 8:70465429-70465451 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1042645230 8:70979674-70979696 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1042698303 8:71582337-71582359 ACTGGGAGACACCTCCCAGTAGG + Intronic
1042853478 8:73240374-73240396 ACTGGGAGACACCTCCCAATAGG - Intergenic
1043129350 8:76441830-76441852 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1043165795 8:76901515-76901537 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1043366265 8:79536908-79536930 ACTGGGAAACACCTCCCAGCAGG - Intergenic
1043368207 8:79560091-79560113 ACTGGGAAACAGCTCCCAGTAGG - Intergenic
1043748803 8:83909359-83909381 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1043844633 8:85150408-85150430 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1044073806 8:87793841-87793863 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1044254627 8:90045766-90045788 ACTGGGAGACACCTCCCAGTAGG + Intronic
1044449125 8:92313572-92313594 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1044521553 8:93205142-93205164 ACTAGCAGACACCTCCCAGTAGG - Intergenic
1044576915 8:93779791-93779813 ACTGGGAGACACCTCCCAGTAGG - Intronic
1044596973 8:93969248-93969270 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1044767608 8:95593465-95593487 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1044956563 8:97487568-97487590 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1044960718 8:97528447-97528469 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1045071106 8:98505813-98505835 ACTGGGAGACACCTCCCAGTAGG - Intronic
1045123459 8:99063798-99063820 ACTGGGAGACACCTCCCAGTAGG + Intronic
1045201801 8:99990834-99990856 ACTGGGAGACACCTCCCAGTAGG + Intronic
1045618979 8:103952310-103952332 ACTAGGAGACACCTCCCAGTAGG + Intronic
1045647076 8:104309289-104309311 ACTGGGGGACACCTCCCAGTAGG + Intergenic
1045883136 8:107064690-107064712 ACTGGGAGACATCTCCCATTAGG - Intergenic
1045933463 8:107653648-107653670 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1046601970 8:116327206-116327228 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1046607963 8:116391431-116391453 ACTGGGCTACACCTCCCAGTAGG + Intergenic
1046609866 8:116411042-116411064 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1046822034 8:118644274-118644296 ATGACACAACACCTCCCATTAGG - Intergenic
1047129411 8:122001951-122001973 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1048149750 8:131883169-131883191 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1048467114 8:134674694-134674716 ACTGGGAGACACCTCCCAGTAGG + Intronic
1048521204 8:135157053-135157075 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1048796437 8:138154020-138154042 ACTAGGAGACACCTCCCAGTAGG + Intronic
1050322505 9:4467364-4467386 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1050368959 9:4901523-4901545 ACTGGGAGACACCTCCCAGTGGG - Intergenic
1050404547 9:5293711-5293733 ACTGGGACACACCTCCCAATAGG + Intergenic
1050407735 9:5327632-5327654 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1050446422 9:5727951-5727973 ACTGGGAGACACCTCCCATTAGG - Intronic
1050504778 9:6336568-6336590 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1050645365 9:7713627-7713649 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1051124884 9:13792339-13792361 ACTGGGGGACACCTCCCAGTAGG + Intergenic
1051238428 9:15025892-15025914 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1051308878 9:15747451-15747473 ACTGGGAGACACCTCCCAGTAGG + Intronic
1051863320 9:21651292-21651314 ACTAGGAGACACCTCCCAGCAGG - Intergenic
1052217383 9:25983265-25983287 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1052714539 9:32099242-32099264 ACTAGGAGACACCTCCGAGTAGG + Intergenic
1052800088 9:32958505-32958527 ACTAGGAGACATCTCCCAGTAGG + Intergenic
1053041700 9:34878941-34878963 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1053568091 9:39274502-39274524 ACTGGGAGACACCTCCCAGTAGG + Intronic
1053583021 9:39426348-39426370 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1053847204 9:42251209-42251231 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1054104600 9:60985091-60985113 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1054129053 9:61344508-61344530 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1054581741 9:66921758-66921780 ACTGGGAGACACCTCCCAGTAGG - Intronic
1054596458 9:67071963-67071985 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1054887208 9:70212035-70212057 ACTGGGAGACACCTCCCAGTAGG - Intronic
1054889201 9:70233199-70233221 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1054997401 9:71407805-71407827 ACTGGGAGACACCTCCCAATAGG + Intronic
1055014002 9:71596237-71596259 ACTCGGAGACACCTCCCAGTAGG + Intergenic
1055125638 9:72716200-72716222 ACTGGGAAACACCTCCCAGTAGG - Intronic
1055614302 9:78054924-78054946 ACTGGGAAACATCTCCCAGTAGG + Intergenic
1055617139 9:78084307-78084329 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1055894881 9:81163103-81163125 ACTGGGACACACCTCCCAATAGG + Intergenic
1056016284 9:82391604-82391626 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1056426285 9:86480610-86480632 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1056700940 9:88907656-88907678 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1057769036 9:97950794-97950816 ACTGGGAAAAACCTCCCAGTAGG - Intergenic
1058012053 9:99989261-99989283 ACTGGGAGACACCTCCCAGTAGG + Intronic
1058074561 9:100637689-100637711 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1058081906 9:100709872-100709894 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1058202945 9:102066601-102066623 ACTAGGAGACACCTCCCAGTAGG - Intergenic
1058454900 9:105129914-105129936 GCTAGGCAACACATTCCATGAGG - Intergenic
1058492418 9:105516391-105516413 ACTAGGAGACACCTCCCAGTAGG + Intronic
1058657768 9:107239888-107239910 ACTAGGCCATACTTCCCATAAGG + Intergenic
1058926075 9:109665607-109665629 ACTGGGAGACACCTCCCAGTAGG - Intronic
1060038171 9:120276573-120276595 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1060133897 9:121133056-121133078 ACTGGGAGACACCTCCCAGTAGG - Intronic
1062743096 9:138192486-138192508 ACTGGGCAAGACCTCCCAACAGG - Intergenic
1062743345 9:138194487-138194509 ACTGGGCAAGACCTCCCAACAGG - Intergenic
1062743594 9:138196488-138196510 ACTGGGCAAGACCTCCCAACAGG - Intergenic
1062759200 9:138329613-138329635 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1203599650 Un_KI270748v1:386-408 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1185806276 X:3060016-3060038 ACTGGGAGACACCTCCCAGTAGG + Intronic
1185911226 X:3982718-3982740 ACTGGGTGACACCTCCCAGTAGG + Intergenic
1186181248 X:6975652-6975674 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1186354283 X:8773641-8773663 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1186585694 X:10870544-10870566 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1186773242 X:12838796-12838818 ACTAGGAGACACCTCCCAGCAGG - Intergenic
1188017604 X:25122577-25122599 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1188044784 X:25413465-25413487 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1188108960 X:26175178-26175200 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1188193290 X:27197687-27197709 ACTAGGAGACACCTCCCAGCAGG + Intergenic
1188271997 X:28152131-28152153 ACTGGGAGACACCTCCCAATAGG - Intergenic
1188944190 X:36278005-36278027 ACTGGGAGACACCTCCCAGTAGG - Intronic
1188954522 X:36418282-36418304 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1189017630 X:37300993-37301015 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1189201115 X:39196441-39196463 CCCATCCAACACCTCCCATTAGG + Intergenic
1189652301 X:43203522-43203544 ACTGGGCAAGACCTCCCTGTGGG - Intergenic
1189721789 X:43927231-43927253 ACTAGGAGACACCTCCCAGCAGG - Intergenic
1189978406 X:46485786-46485808 ACTGGGAGACACCTCCCAGTAGG - Intronic
1190076061 X:47318035-47318057 ACTAGTTAAAACTTCCCATTGGG + Intergenic
1190209617 X:48434167-48434189 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1190622299 X:52299423-52299445 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1190840859 X:54142822-54142844 ACTGGGAGACACCTCCCAGTAGG + Intronic
1191003748 X:55688544-55688566 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1191043179 X:56107135-56107157 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1191096135 X:56674391-56674413 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1191111948 X:56811193-56811215 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1191113874 X:56832022-56832044 ACTAAGAGACACCTCCCAGTAGG - Intergenic
1191122436 X:56920572-56920594 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1191155822 X:57271465-57271487 ACTAGGAGACACCTCCAAGTAGG + Intergenic
1191204025 X:57815856-57815878 ACTAGGAGACACCTCCCAGTAGG - Intergenic
1191645710 X:63478719-63478741 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1191711430 X:64153308-64153330 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1191733528 X:64364315-64364337 ACTGGGAGACACCTCCCAGTAGG + Intronic
1191775558 X:64809100-64809122 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1191824222 X:65347003-65347025 ACTAGGAGATACCTCCCACTAGG + Intergenic
1191882373 X:65856081-65856103 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1191886506 X:65894076-65894098 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1191941917 X:66489909-66489931 ATTGGGCAACACCTCCCAGTAGG + Intergenic
1191984908 X:66969175-66969197 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1192061380 X:67830734-67830756 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1192287635 X:69755471-69755493 ACTGGGAGACACCTCCCAGTAGG - Intronic
1192393699 X:70756342-70756364 ACTGGGAGACACCTCCCAGTAGG + Intronic
1192522998 X:71817388-71817410 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1192628981 X:72760405-72760427 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1192637111 X:72830567-72830589 ACTGGGAGACACCTCCCAGTAGG - Intronic
1192644603 X:72890247-72890269 ACTGGGAGACACCTCCCAGTAGG + Intronic
1192652729 X:72960409-72960431 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1192688351 X:73331695-73331717 AGTGGGAAACACCTCCCAGTAGG + Intergenic
1192694806 X:73402066-73402088 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1192727559 X:73768624-73768646 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1192755758 X:74046041-74046063 ACTAGGAGACACCTCCCAGCAGG - Intergenic
1192936347 X:75862656-75862678 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1192997427 X:76527262-76527284 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1193001610 X:76568754-76568776 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1193019894 X:76780505-76780527 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1193035928 X:76951097-76951119 ACTGGGAAACACCTCCAAATAGG + Intergenic
1193161292 X:78232501-78232523 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1193281468 X:79655873-79655895 ATTGGGAAACACCTCCCAGTAGG - Intergenic
1193316006 X:80065980-80066002 ACTTGGAGACACCTCCCAGTAGG - Intergenic
1193355921 X:80520631-80520653 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1193376463 X:80767277-80767299 ACTGGGAGACACTTCCCATTAGG + Intronic
1193419855 X:81270644-81270666 ACTGGGAGACACCTCCCAGTAGG - Intronic
1193661803 X:84267302-84267324 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1194029097 X:88789593-88789615 ACTGGGCAAGACCTCCCAACTGG - Intergenic
1194118930 X:89937241-89937263 ACTGGGAGACACCTCCCAGTTGG - Intergenic
1194341954 X:92716270-92716292 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1194509007 X:94768923-94768945 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1194635694 X:96342950-96342972 ACTAGGCAGGACCTCCCAACCGG - Intergenic
1194761699 X:97803322-97803344 ACTGGGAGACACCTCCCAATAGG - Intergenic
1195098077 X:101525025-101525047 ACTGGGAGACACCTCCCAGTAGG + Intronic
1195102373 X:101567559-101567581 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1195508325 X:105684758-105684780 ACTGGGAGACACCTCCCAGTAGG + Intronic
1195580209 X:106493258-106493280 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1195622099 X:106967032-106967054 ACTGGGAGACACCTCCCAGTAGG + Intronic
1195737038 X:108022746-108022768 ACTAGGCCCCATCTCCAATTTGG - Intergenic
1195947460 X:110230232-110230254 ACTGGGAGACACCTCCCAGTAGG + Intronic
1195985646 X:110627018-110627040 ACTGGGAAACACCTCCCAGCAGG + Intergenic
1195988396 X:110657606-110657628 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1196012465 X:110903745-110903767 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1196139545 X:112246134-112246156 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1196159068 X:112462526-112462548 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1196435662 X:115672273-115672295 ACTAGGAGACACCTCCCAGCAGG + Intergenic
1197004013 X:121474324-121474346 ACTAGGAGACACTTCCCAGTAGG - Intergenic
1197144803 X:123159630-123159652 ATGACCCAACACCTCCCATTAGG + Intergenic
1197157295 X:123283948-123283970 ACTAGGAGACACCTCCCAACAGG + Intronic
1197314934 X:124954181-124954203 ACTAGGTGACTCCTACCATTTGG + Intronic
1198072231 X:133160054-133160076 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1198293647 X:135263232-135263254 ACTGGGAGACACCTCCCAGTAGG - Intronic
1198366052 X:135941174-135941196 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1198571346 X:137960383-137960405 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1198595528 X:138231432-138231454 ACTTGGAGACACCTCCCAGTAGG + Intergenic
1198663546 X:138996880-138996902 ACTGGGATACACCTCCCAGTAGG + Intronic
1198843669 X:140886061-140886083 AGATGGAAACACCTCCCATTAGG - Intergenic
1199181045 X:144854343-144854365 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1199292394 X:146119561-146119583 ACTAGGAGACACCTCCCAGTAGG + Intergenic
1199383828 X:147201000-147201022 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1199449959 X:147968127-147968149 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1199478778 X:148274459-148274481 ACTGGGCAAGACCTCCCAAAGGG + Intergenic
1199637055 X:149824241-149824263 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1199741598 X:150740972-150740994 ATGACCCAACACCTCCCATTAGG + Intronic
1199778956 X:151040853-151040875 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1199911785 X:152295113-152295135 ACTAGGAGACACCTCCCAATAGG - Intronic
1199914570 X:152325429-152325451 ACTGGGAGACACCTCCCAGTAGG + Intronic
1200269679 X:154670747-154670769 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1200371350 X:155728232-155728254 ACTAGGAGACACCTCCCAGTAGG - Intergenic
1200471806 Y:3594795-3594817 ACTGGGAGACACCTCCCAGTTGG - Intergenic
1200650301 Y:5832963-5832985 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1200732515 Y:6758085-6758107 ACTGGGAGACACCTCCCAGTAGG - Intergenic
1200805454 Y:7428699-7428721 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1200839133 Y:7762268-7762290 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1200850993 Y:7883046-7883068 AATAGTCAACATCTCTCATTTGG + Intergenic
1200908211 Y:8507501-8507523 ACAAAGAAACACCTCCCACTAGG - Intergenic
1201182219 Y:11359500-11359522 ACTGGGACACACCTCCCAGTAGG + Intergenic
1201251035 Y:12057757-12057779 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1201371408 Y:13268965-13268987 ACTAGGAGACACCTCCCAGCAGG - Intronic
1201519685 Y:14859689-14859711 ACTGGGAGACACCTCCCAGTAGG + Intergenic
1201633785 Y:16099299-16099321 ACTAGGAGACACCTCCCAGCAGG + Intergenic
1201752182 Y:17445147-17445169 ACTGGGAAACACCTCCCAGTAGG - Intergenic
1201756748 Y:17494454-17494476 ACTGGGCAAGACCTCCCAAAAGG + Intergenic
1201844805 Y:18411530-18411552 ACTGGGCAAGACCTCCCAAAAGG - Intergenic
1201952960 Y:19585863-19585885 ACTAGGAGACACCTCCCAGTAGG - Intergenic
1201979287 Y:19890403-19890425 ACTGGGCAACACCTCTGACTAGG - Intergenic
1202054750 Y:20818223-20818245 ACTGGGAAACATCTCCCAGTAGG + Intergenic
1202054882 Y:20819184-20819206 ACTGGGAAACACCTCCCAGTAGG + Intergenic
1202342200 Y:23881746-23881768 ACTAGGGAACACATCCCAGCAGG - Intergenic
1202528569 Y:25788339-25788361 ACTAGGGAACACATCCCAGCAGG + Intergenic