ID: 974874404

View in Genome Browser
Species Human (GRCh38)
Location 4:67685642-67685664
Sequence TAATGGGAGGTGTTGCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874399_974874404 -7 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874394_974874404 22 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874395_974874404 21 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874401_974874404 -8 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874397_974874404 -6 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874404 Original CRISPR TAATGGGAGGTGTTGCCTAG TGG Intronic
902979846 1:20114765-20114787 TAATGGCAAGAGTTGCCTAGGGG + Intronic
903632424 1:24786164-24786186 TAAGGGGTGGTGATGACTAGGGG - Intronic
904968789 1:34402616-34402638 TATTGGGAGGTGGGGCCTAATGG - Intergenic
905277296 1:36826732-36826754 TAATAGGAGGTGGTGCGGAGTGG + Intronic
906606451 1:47175773-47175795 TCAAGGCAGGTGTAGCCTAGTGG - Intergenic
907816003 1:57918887-57918909 TATTGGGAAGTGGGGCCTAGTGG - Intronic
909365328 1:74813833-74813855 TATTGGGAGGTGGGGCTTAGTGG - Intergenic
909381208 1:75000754-75000776 GAATGGGAGCTGTTGCTTAGTGG - Intergenic
909669536 1:78172563-78172585 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
909884201 1:80920176-80920198 TATTGGGAGGTAGGGCCTAGTGG - Intergenic
914434008 1:147644038-147644060 TACTGGGAGGTGGAGCCTAATGG - Exonic
914904473 1:151732542-151732564 GCATGGGAGGTGTTTGCTAGTGG + Intergenic
916301615 1:163281580-163281602 TAGTGGGAGGTGTTGACTCATGG - Intronic
917471349 1:175328532-175328554 CATTGTGTGGTGTTGCCTAGAGG + Intronic
917617776 1:176764174-176764196 TATTGGTAGGTGGGGCCTAGTGG - Intronic
918010580 1:180582933-180582955 TGCTGGGAGGTGTGGCCTAATGG + Intergenic
919054704 1:192555055-192555077 TAATGGAAAGTGTGGTCTAGAGG + Intergenic
919209131 1:194456136-194456158 TGATGGGAGGTGCTGCCGTGAGG + Intergenic
921436110 1:215124666-215124688 TGATTGGAGGTGTTTCCTAACGG - Exonic
923392228 1:233523762-233523784 TACTGGGGTGTGTTGCCCAGGGG + Intergenic
924722767 1:246638614-246638636 TTTTGGGAGGTGGTTCCTAGGGG + Intronic
924902190 1:248412632-248412654 TGTTGAGAGGTGGTGCCTAGTGG + Intergenic
924950151 1:248874642-248874664 GAATGGCACCTGTTGCCTAGAGG + Intergenic
1063413473 10:5854471-5854493 CAATGGCTGGAGTTGCCTAGTGG + Intergenic
1063722803 10:8601473-8601495 TGTTGGGAGGTGTGGCCTAGAGG + Intergenic
1065317658 10:24479962-24479984 TGCTGGGAGGTGGGGCCTAGTGG - Intronic
1066339097 10:34512009-34512031 TGTTGGGAGGTGTGGCCTAATGG - Intronic
1068631546 10:59303669-59303691 TGTTGGGAGGTGGGGCCTAGTGG + Intronic
1069585444 10:69597866-69597888 TATTGGGAGGTGTGGCCTTTGGG - Intergenic
1070763240 10:79038916-79038938 TGGTGGGAGGTGGGGCCTAGTGG + Intergenic
1071978074 10:90975489-90975511 TATTGGGAGATGGGGCCTAGTGG - Intergenic
1072465410 10:95657778-95657800 TATTGGGAGGTGGGGCCTAATGG + Intergenic
1073618351 10:105021379-105021401 TATTGGGAGGTGGGGCCTAATGG - Intronic
1075290821 10:121228994-121229016 TAATGGGAGGTGCAGCCTCAAGG + Intergenic
1077323683 11:1954081-1954103 TCATGGGAGGTGGGGCCCAGAGG - Intronic
1079301119 11:19279716-19279738 TAATGGGAGGTGTTGGGTCATGG - Intergenic
1079834941 11:25322907-25322929 TGATGGGAGGGGCTGCCTCGAGG - Intergenic
1083720022 11:64599438-64599460 TGATGGGAGGTGCTGGCAAGAGG - Intronic
1086541049 11:87913606-87913628 TATTGGGAGGTGGGCCCTAGTGG + Intergenic
1087048667 11:93865540-93865562 TTTTGGGAGGTGGTTCCTAGGGG + Intergenic
1087147510 11:94826716-94826738 CATTGGGAGGTGGGGCCTAGTGG - Intronic
1087790675 11:102403689-102403711 TCTTGGGAGGTGGGGCCTAGTGG + Intronic
1091356022 11:134938394-134938416 CACTGGGAGGTGGGGCCTAGTGG - Intergenic
1202806670 11_KI270721v1_random:9276-9298 TCATGGGAGGTGGGGCCCAGAGG - Intergenic
1091678183 12:2506722-2506744 TCATGGGAGGCGGTGCCTTGAGG - Intronic
1092609694 12:10159095-10159117 TCATGGGATGTGTGGCCCAGAGG - Exonic
1093334202 12:17880683-17880705 TATTGGGAGGTAGGGCCTAGTGG - Intergenic
1094456720 12:30643535-30643557 TTTTGGGAGGTGGGGCCTAGTGG + Intronic
1095156086 12:38856547-38856569 TAATGGCATGGGTTGCCTAGAGG + Intronic
1095390633 12:41701903-41701925 TTATGGGAGGGCTTGACTAGTGG - Intergenic
1097392506 12:59032850-59032872 GAATGAGAGATGTTGCCTAATGG + Intergenic
1099249845 12:80240650-80240672 TATTGTGATGTGTTGCCTATAGG + Intronic
1099259099 12:80354056-80354078 TGCTGGGAGGTGTGGCCTAGTGG + Intronic
1099803221 12:87482940-87482962 TATTGGGAGGTGTGGCCTTTGGG + Intergenic
1099861870 12:88232052-88232074 TTTTGGGAGGTGGTTCCTAGGGG - Intergenic
1101214957 12:102572056-102572078 TTTTGGGAGGTGGGGCCTAGTGG + Intergenic
1101703157 12:107194173-107194195 TGCTGGAAGGTGGTGCCTAGTGG - Intergenic
1103456488 12:121070803-121070825 GAATGTGGGATGTTGCCTAGAGG + Intergenic
1103478529 12:121235915-121235937 TATTGGGAGGTGAAGCCTTGGGG + Intergenic
1104220743 12:126782580-126782602 TAATGGAAAGTGTTGCTTATAGG + Intergenic
1105515151 13:21082922-21082944 TGTTGGGAGGTGAGGCCTAGTGG - Intergenic
1106095379 13:26638805-26638827 TGTTGGGAGGTATGGCCTAGTGG + Intronic
1106861308 13:33911824-33911846 TATTGGGAGGTGGGTCCTAGTGG - Intronic
1107128812 13:36873027-36873049 TAATGGGAGTAGTTCCCAAGGGG - Intronic
1107459711 13:40590067-40590089 TATTGGGAGGAGTTGGGTAGGGG - Intronic
1108259043 13:48638717-48638739 TATTGGGAGGTGGGGCCTACTGG - Intergenic
1110607052 13:77445218-77445240 TATTGGGTGGTGGGGCCTAGTGG - Intergenic
1111571129 13:90087667-90087689 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
1115151131 14:30286931-30286953 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1115841243 14:37473055-37473077 TGCTGGGAGGTGGAGCCTAGTGG + Intronic
1116143961 14:41039360-41039382 TAATTGAAGGTGTTTCCTTGGGG - Intergenic
1116500785 14:45618477-45618499 CATTGGGAGGTGGGGCCTAGGGG - Intergenic
1116987452 14:51236577-51236599 TATTGGGAGGTGGGGCCTATTGG - Intergenic
1118022404 14:61731635-61731657 CAAAGTGAGGTGTTGCCTAGGGG + Intronic
1118942249 14:70348602-70348624 TTTTGGGAGGTGGTGCCTGGGGG - Intronic
1119714720 14:76850915-76850937 TAATGGGAGGAATTGCCTTTAGG - Intronic
1119750206 14:77071981-77072003 TGGTGGGAGGTGGGGCCTAGTGG - Intergenic
1120958353 14:90102599-90102621 TAATGGGAGGAATTTCATAGGGG - Intronic
1124372768 15:29112840-29112862 AAATGGGCGGTGGTGCTTAGTGG - Intronic
1126078172 15:44933230-44933252 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1128930067 15:71696471-71696493 TGTTGGGAGGTGGCGCCTAGTGG - Intronic
1131724779 15:95209313-95209335 TACTGGCAGGTGTGGCCTAGTGG - Intergenic
1132694445 16:1195651-1195673 AAATGGGAGGTGTGTTCTAGAGG + Intronic
1133716233 16:8452045-8452067 TAATGGGATGAGTTCCCTAAAGG + Intergenic
1134010733 16:10850530-10850552 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1134768739 16:16785430-16785452 TATTGGGAGGTGGGGCCTAGTGG + Intergenic
1135819865 16:25674393-25674415 TATTGGGAGGTGGGACCTAGTGG + Intergenic
1137376359 16:47955417-47955439 TAATGGGAGTAGGGGCCTAGAGG - Intergenic
1138215368 16:55199997-55200019 TGATGGAAGGTGGGGCCTAGTGG + Intergenic
1138849771 16:60613450-60613472 TATTGGGAGGTGTGGCCTTTTGG - Intergenic
1140127405 16:72129738-72129760 TAATGGGAGCTGGTGCTGAGTGG + Intronic
1143137795 17:4721374-4721396 TAATGGGAGGTGTTGGTGTGAGG - Exonic
1144938008 17:18915782-18915804 TATTGAGAGGTGGGGCCTAGTGG - Intronic
1146759672 17:35466086-35466108 TAATGGGAGATGTTGCTAATGGG - Intronic
1147552441 17:41453677-41453699 GAATTGGAGGGGTTGCCTGGGGG - Intergenic
1149359617 17:55880430-55880452 AAATGGGAGATGTTGGCTAAAGG + Intergenic
1150531176 17:65983467-65983489 TAGTGGGAGGTGTTGGCTTATGG + Intronic
1151415577 17:73960581-73960603 TGATGGCAGGGGCTGCCTAGAGG - Intergenic
1155945525 18:31845746-31845768 TAATGGGAGGGGTTGCCTTCAGG + Intronic
1156170740 18:34482126-34482148 TGTTGGGAGGTGGTGCCTAGTGG + Intergenic
1156522565 18:37734164-37734186 TAAGGGAAGATGTTGCCTTGAGG + Intergenic
1157448608 18:47767903-47767925 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1157771889 18:50356218-50356240 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
1157920324 18:51707512-51707534 TTTTGGGAGGTGGTGCCTAGGGG - Intergenic
1158380384 18:56923498-56923520 TAATGAGAGGTGTTACTGAGGGG + Intronic
1158487917 18:57884527-57884549 TGTTGGGAGGTGGAGCCTAGTGG - Intergenic
1159195207 18:65104561-65104583 TATTGGGAGGTGTGGCCTTTGGG - Intergenic
1163022394 19:14489948-14489970 TGTTGGGAGGTGGGGCCTAGTGG + Intronic
1163096889 19:15065161-15065183 TACACGGATGTGTTGCCTAGTGG - Intergenic
1163429203 19:17256872-17256894 TGATGGAAGGTGGTGCCTAGTGG - Intronic
1167082429 19:47286062-47286084 TATTGGGAGGTGTGGCCTTTTGG + Intergenic
1167770310 19:51510630-51510652 TCCTGGGAGGTGCTGCCAAGAGG + Intergenic
927011696 2:18910949-18910971 TAATGGGAGGTGTTGGGTCATGG + Intergenic
927261688 2:21098073-21098095 TCATGGGAGGTTATGTCTAGGGG - Intergenic
928288213 2:30011974-30011996 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
931263124 2:60637613-60637635 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
931685815 2:64791659-64791681 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
932559778 2:72856966-72856988 TGTTGGGAGGTGGGGCCTAGCGG - Intergenic
934892235 2:98080721-98080743 TATTGGGAGGTGGGGCCTAATGG - Intergenic
935979311 2:108610944-108610966 TAATGGAAGGTGCTGACAAGAGG - Intronic
936629049 2:114180533-114180555 TGGTGGGAGGTGGTGCCTAGTGG + Intergenic
936697355 2:114966277-114966299 TCTTGGGAGGTGGGGCCTAGAGG + Intronic
937858417 2:126689492-126689514 TGATGGGAGGTGGGACCTAGTGG + Intronic
937858921 2:126693103-126693125 TGATGGGAGGTGGGACCTAGTGG + Intronic
938676635 2:133642271-133642293 TATTGGGAGGTGGTGCCTACTGG - Intergenic
939496405 2:142932709-142932731 TTTTGGGAGGTAGTGCCTAGGGG + Intronic
940332798 2:152493498-152493520 TGTTGGGAGGTGGAGCCTAGTGG + Intronic
940721247 2:157284780-157284802 TAACGGGAGGCCTTGCCTACTGG + Intronic
940758656 2:157712556-157712578 TAATGGGAGGTGGTGACTAGTGG - Intergenic
941140842 2:161779300-161779322 TATTGGGAGGTGGAGCCTAGTGG - Intronic
941630722 2:167881265-167881287 TAGGGGGAGGTGTTTCCCAGAGG + Intergenic
943380387 2:187137506-187137528 TTATGGGAGGTGATGGATAGAGG - Intergenic
943817775 2:192277720-192277742 TGATGGGAGAGGTTGCCTTGAGG + Intergenic
944329243 2:198445672-198445694 TATTGGGAGGTGTGGCCTTTGGG + Intronic
944883045 2:204034594-204034616 GAAATGGAGGTCTTGCCTAGAGG + Intergenic
945277754 2:208005195-208005217 TAATGTGAGATGTTACATAGAGG - Intronic
945805858 2:214488944-214488966 TAATGGGAGGTGTTGGGTGATGG - Intronic
946875157 2:224122029-224122051 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
947016787 2:225629847-225629869 TGTTGGGAGGTGGGGCCTAGTGG - Intronic
948950351 2:241246728-241246750 TAATGGGAGATGTTTTCTAATGG - Intronic
1169390747 20:5188945-5188967 CACTGGGAGGTGATGCCTAGTGG - Intronic
1169616976 20:7458911-7458933 TAATGGGAGGTGTTGCATTATGG + Intergenic
1175630958 20:60536046-60536068 TATTGGGAGGTGTGGCCTTTAGG + Intergenic
1177804534 21:25861279-25861301 TATTGGGAGGTGGTGCCTTTCGG + Intergenic
1178786287 21:35656712-35656734 TGTTGGGAGGTGGGGCCTAGTGG + Intronic
1179667124 21:42920607-42920629 TTTTGGGAGGTGGTTCCTAGGGG + Intergenic
1180027630 21:45176950-45176972 TCATGGGGGGGGTTGCCTAACGG - Intronic
1180173216 21:46071726-46071748 TCATGGAAGGTGCTGCCTGGGGG + Intergenic
1180259170 21:46656027-46656049 TGTTGGGAGGTGGGGCCTAGTGG + Intronic
1184346339 22:43915809-43915831 TATTGGGAGGTGGGGCCTAATGG + Intergenic
951059756 3:18191476-18191498 TTATGGTATGTGTTACCTAGTGG - Intronic
951322045 3:21256947-21256969 TAATGGGAGGTACTGGATAGGGG - Intergenic
951522819 3:23625427-23625449 TAATTGGAGGTGGGGCCTAGGGG - Intergenic
951665142 3:25114538-25114560 AAATGGGAGGTGGTGGCAAGTGG - Intergenic
953560350 3:43985229-43985251 TATTGGGAGGTAGGGCCTAGTGG + Intergenic
955316253 3:57941577-57941599 TGTTGGGAGGTGAAGCCTAGTGG - Intergenic
955551085 3:60086283-60086305 TGATGGGAGGTGGGGCCTGGGGG - Intronic
955681536 3:61506478-61506500 TAATGGGAGCTGTTGGGTAGTGG + Intergenic
956704958 3:71991663-71991685 AAATTGGAGGTGAGGCCTAGTGG - Intergenic
957285299 3:78209958-78209980 CAATGGGAGGTGTTGGATCGTGG + Intergenic
958017037 3:87950218-87950240 TATTGGGAGGTGGGGCCCAGTGG - Intergenic
958863689 3:99474760-99474782 TATTGGGAGATGGGGCCTAGTGG + Intergenic
962006072 3:131351409-131351431 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
963003017 3:140700836-140700858 TACTGGGAGCTGTTGTCTATTGG + Intronic
964414665 3:156434760-156434782 TAATGAGAGGTGATAACTAGTGG + Intronic
964433087 3:156625331-156625353 TAATGGGTGGGGCTGCCTAATGG + Intergenic
965795490 3:172434403-172434425 TGTTGGGAGGTGAGGCCTAGTGG - Intergenic
967248850 3:187516522-187516544 TCATGGAAGGTGATGCCAAGTGG - Intergenic
968747649 4:2369131-2369153 TAAGGGCAGGTGGTGCTTAGAGG + Intronic
970057612 4:11993623-11993645 TGATGGGAGGGGTTGCCACGTGG - Intergenic
970794134 4:19891691-19891713 TTTTGGGAGGTGGTGCCTAGGGG - Intergenic
972006018 4:34107501-34107523 CAATTTGAGATGTTGCCTAGAGG + Intergenic
972693354 4:41420788-41420810 TGATGGCAGGTGTTACCTTGTGG + Intronic
972741326 4:41889516-41889538 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
973052391 4:45611429-45611451 TTTTGGGAGGTGGTACCTAGAGG - Intergenic
973660432 4:53099765-53099787 TAATGGGAGGTGTTTGTTTGAGG - Intronic
973850632 4:54958129-54958151 TAATGGGAGGTGGGGCCTTTGGG - Intergenic
974006412 4:56561663-56561685 TAATGGGAGGTGTTGGGTCATGG - Intronic
974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG + Intronic
975175066 4:71279210-71279232 GAATGGGAGGTGTTGCTCAAAGG - Intronic
977186944 4:93950767-93950789 TATTGGGAGGTGGGGCCTAATGG + Intergenic
977568937 4:98610322-98610344 TGATGGGAGGTGGAGCCTAATGG - Intronic
977691267 4:99914181-99914203 TGTTGGGAGGTGTAGCCTAGTGG - Intronic
979601665 4:122592309-122592331 TAATGGGAGGCGGGGCCTAGTGG - Intergenic
980240027 4:130161202-130161224 TGATGGTGGGTTTTGCCTAGTGG - Intergenic
981605817 4:146538963-146538985 TGTTGGGAGGTGTGGCCTTGGGG - Intergenic
981805346 4:148709069-148709091 CAATGTGAGGAGGTGCCTAGTGG - Intergenic
982086212 4:151839391-151839413 TGATGGGAGGTGTTGCCTTTTGG + Intergenic
982346249 4:154363561-154363583 TAATTGGAGATGTTGCCCAAAGG + Intronic
984810144 4:183788776-183788798 TATTGGGAGGTGGGGCCTAGTGG - Intergenic
984841603 4:184073261-184073283 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
986243923 5:5988030-5988052 TGATGGGAGGTGAAGCCCAGTGG - Intergenic
987067056 5:14300116-14300138 TACTGGTAGATGTTGCTTAGGGG + Intronic
987228000 5:15863644-15863666 TCCTGGGAGGTGGGGCCTAGTGG + Intronic
988288251 5:29250240-29250262 TGTTGGGAGGTGAGGCCTAGAGG + Intergenic
989066451 5:37467477-37467499 TATTGGGAGGTGTGGCCTTTAGG - Intronic
989644841 5:43620062-43620084 TATTGGGAGGTGGGGCCTAGTGG - Intronic
990772722 5:59267961-59267983 TAATGGCAGCTTTTGCCCAGAGG + Intronic
991538537 5:67700614-67700636 TAATGGGAGATATTGACAAGCGG - Intergenic
992691305 5:79243024-79243046 TAGAGAAAGGTGTTGCCTAGTGG + Intronic
993983516 5:94570161-94570183 GAATGGGAGGGGATGCCTAAGGG - Intronic
994845150 5:104979522-104979544 TGTTGGGAGGTGGAGCCTAGTGG - Intergenic
995764453 5:115600856-115600878 GAATGGGATGTGTGGTCTAGGGG + Intronic
996676924 5:126186875-126186897 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
996777848 5:127152249-127152271 TTTTGGGAGGTGGGGCCTAGTGG - Intergenic
997570459 5:134923406-134923428 GAATGGGAGGTGATTCCTAGGGG + Intronic
999019366 5:148146625-148146647 TGTTGGGAGGTGAGGCCTAGTGG - Intergenic
1000410720 5:160933346-160933368 TGATGGGAGGGGCTGGCTAGTGG - Intergenic
1001038836 5:168317449-168317471 GGATGGGAGGTGTGGCCCAGGGG + Intronic
1001171865 5:169427030-169427052 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1001923730 5:175620927-175620949 TATTGGGAGGTGTAGCCTTTGGG + Intergenic
1001958371 5:175864006-175864028 TAAAAGGAGGTTTTGTCTAGTGG + Intronic
1003509128 6:6764797-6764819 ATATTGGAGGTGTGGCCTAGTGG + Intergenic
1004481551 6:16024190-16024212 TAATGGGATGTGTAGTCTCGAGG - Intergenic
1007275373 6:40669454-40669476 TATTGGGAGGTGTGGCCTTTGGG + Intergenic
1010003388 6:70970526-70970548 TATTGGGAGGTAGGGCCTAGTGG - Intergenic
1010125040 6:72421649-72421671 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1010526967 6:76912662-76912684 TATTGGGAGGTGGGGCCTAGTGG + Intergenic
1011293801 6:85805991-85806013 TAATGGGAGATCTTACCTACAGG - Intergenic
1012532219 6:100251645-100251667 TAATGGGAGGTAAGGCCTAATGG + Intergenic
1013120579 6:107137188-107137210 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1013469919 6:110454085-110454107 TGTTGGGAGGTGAGGCCTAGTGG - Intronic
1013844271 6:114430671-114430693 TGCTGGGAGGTGAGGCCTAGTGG + Intergenic
1014072254 6:117196398-117196420 TAACGGGATGTGTTGCTTTGAGG - Intergenic
1015092610 6:129376554-129376576 TGATGGGAGATGTGGCCAAGGGG - Intronic
1018908559 6:168089007-168089029 GAATGGGAGCTGTGGCTTAGGGG + Intergenic
1025104579 7:56160697-56160719 TATTGGGAGGTGAAGCCTAGAGG - Intergenic
1025952748 7:66158348-66158370 TATTGGGAGGTGGGGCCTAATGG + Intergenic
1026313334 7:69207184-69207206 TATTGGGAGGTGAAGTCTAGAGG - Intergenic
1027488253 7:78788722-78788744 TAGTGGGAGGTATTCCCTAAGGG - Intronic
1027711046 7:81601751-81601773 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
1028023951 7:85813263-85813285 TAATGTCAGATATTGCCTAGAGG + Intergenic
1033423000 7:141219179-141219201 CAGTGGGAGGGGCTGCCTAGAGG + Intronic
1034878486 7:154745870-154745892 TCATGGGAGGTGGGGTCTAGTGG - Intronic
1036582659 8:10089938-10089960 TGTTGGGAGGTGGTGCCTCGTGG - Intronic
1037783148 8:21885125-21885147 AAATGGGAGTTGTTGCTTAATGG + Intergenic
1038353755 8:26806871-26806893 TAATGAGAGAAGATGCCTAGAGG + Intronic
1038969535 8:32617400-32617422 TAATCTGAGATCTTGCCTAGGGG - Intronic
1039059612 8:33563271-33563293 AAGTGGGAGGTTTTGCCAAGGGG - Intronic
1040906011 8:52470418-52470440 TGCTGGGAGGTGGGGCCTAGTGG + Intergenic
1042856271 8:73271281-73271303 TGTTGGGAGGTGAGGCCTAGTGG + Intergenic
1043483336 8:80674682-80674704 TGTTGGGAGGTGGGGCCTAGTGG - Intronic
1044923897 8:97193441-97193463 TATTGGGAGGTGGGGGCTAGTGG + Intergenic
1045194026 8:99911841-99911863 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1045423434 8:102039739-102039761 TGTTGGGAGGTGGGGCCTAGTGG + Intronic
1046822035 8:118644276-118644298 TAATGGGAGGTGTTGTGTCATGG + Intergenic
1047185663 8:122630917-122630939 TATTGGGAGGTGGGGCCTAATGG - Intergenic
1047209761 8:122831908-122831930 TCTTGGGAGGTGGTGCCTAGCGG + Intronic
1047330948 8:123886269-123886291 TGTTGAGAGGTGTGGCCTAGTGG + Intronic
1048077312 8:131085815-131085837 TGCTGGGAGGTGGAGCCTAGTGG + Intergenic
1049036523 8:140080668-140080690 TGTTGGGAGGTGGGGCCTAGCGG - Intronic
1051058134 9:13012241-13012263 TGTTGGGAGGTGAGGCCTAGTGG - Intergenic
1053084322 9:35204996-35205018 TAATGGGAGGTGATGGATAATGG + Intronic
1053459672 9:38258557-38258579 TATTGGGAGGTGGGGCCTAATGG - Intergenic
1055332322 9:75197237-75197259 TATTGGGAGGTGGGGCCTAATGG - Intergenic
1056371339 9:85957545-85957567 TGTTGGGAGGTGAGGCCTAGTGG - Intronic
1056995065 9:91448546-91448568 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1057422035 9:94920379-94920401 AAATGGGAGGGGTGGCCTGGGGG + Intronic
1058246758 9:102635880-102635902 TGTTGGGAGGTGGGGCCTAGTGG - Intergenic
1058920378 9:109608876-109608898 TATTGGGAGGTATGGCCTAATGG - Intergenic
1060984261 9:127810562-127810584 AAATGGGAGATGATACCTAGGGG - Intronic
1061634058 9:131894809-131894831 TGTTGGGAGGTGGGGCCTAGTGG + Intronic
1202630878 M:15368-15390 GAATGGGAGGTGATTCCTAGGGG - Intergenic
1187101370 X:16196354-16196376 TATTGGGAGGTAGTGCCTCGTGG + Intergenic
1188528202 X:31108460-31108482 TGTTGGGAGGCGTGGCCTAGTGG + Intronic
1189201112 X:39196439-39196461 TAATGGGAGGTGTTGGATGGGGG - Intergenic
1190369190 X:49725537-49725559 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
1194084732 X:89511355-89511377 ATATTGGAGGTGGTGCCTAGGGG - Intergenic
1195647333 X:107247116-107247138 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
1195747594 X:108134510-108134532 TAGTGGGAGGAGTAGCTTAGCGG - Intronic
1196015914 X:110939736-110939758 TGTTGGGAGGTGGGGCCTAGTGG + Intergenic
1197128385 X:122974306-122974328 TAAAGGGAGGTCTTGCCAATGGG - Intergenic
1197144802 X:123159628-123159650 TAATGGGAGGTGTTGGGTCATGG - Intergenic
1197973636 X:132141440-132141462 TATTGAGAGGTGGGGCCTAGTGG + Intergenic
1197983084 X:132238832-132238854 TGCTGGGAGGTGTGGCCTAATGG - Intergenic
1199741597 X:150740970-150740992 TAATGGGAGGTGTTGGGTCATGG - Intronic
1200437378 Y:3167242-3167264 ATATTGGAGGTGGTGCCTAGGGG - Intergenic
1201275049 Y:12288612-12288634 TAATGGGAGTTGTTCCCTCATGG - Intergenic