ID: 974874405

View in Genome Browser
Species Human (GRCh38)
Location 4:67685643-67685665
Sequence AATGGGAGGTGTTGCCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 417}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874395_974874405 22 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417
974874394_974874405 23 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417
974874401_974874405 -7 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417
974874399_974874405 -6 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417
974874397_974874405 -5 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874405 Original CRISPR AATGGGAGGTGTTGCCTAGT GGG Intronic
902979847 1:20114766-20114788 AATGGCAAGAGTTGCCTAGGGGG + Intronic
904554435 1:31349517-31349539 GATGGGGGGTTTTGCCTTGTGGG + Intronic
904925691 1:34046249-34046271 AATGGTATGTGTTTCCTTGTTGG - Intronic
904968788 1:34402615-34402637 ATTGGGAGGTGGGGCCTAATGGG - Intergenic
907615306 1:55918394-55918416 AGTTGGAGGTGAGGCCTAGTGGG - Intergenic
908639273 1:66204254-66204276 ACTGGGAGGTACTGCCCAGTAGG - Intronic
908766615 1:67560083-67560105 AATGGCAGGAGTTTCATAGTTGG - Intergenic
908943754 1:69468895-69468917 ATTGGGAGGTGGAGCCTAGTCGG - Intergenic
909365327 1:74813832-74813854 ATTGGGAGGTGGGGCTTAGTGGG - Intergenic
909669537 1:78172564-78172586 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
909769038 1:79397265-79397287 CATTGGAGGTGGAGCCTAGTGGG - Intergenic
909884200 1:80920175-80920197 ATTGGGAGGTAGGGCCTAGTGGG - Intergenic
910616748 1:89206453-89206475 AATTGGAGGAGATGCCTGGTGGG + Intergenic
911155380 1:94631211-94631233 AATGGGAAGTGATGGCTAATGGG - Intergenic
912174192 1:107138349-107138371 AGTGGGAGGTGTTACCTAACTGG + Intergenic
913051512 1:115120479-115120501 GATGGGAGGGGTTGCCTTGAAGG + Intergenic
914434007 1:147644037-147644059 ACTGGGAGGTGGAGCCTAATGGG - Exonic
915694187 1:157722245-157722267 GATGGGAGGTGTTGTCAAGAAGG + Intergenic
915712029 1:157909336-157909358 GTTGGGAGGTGAAGCCTAGTAGG + Intergenic
915973358 1:160369078-160369100 AAGGGGAGTTGTTGTTTAGTGGG - Intronic
916301614 1:163281579-163281601 AGTGGGAGGTGTTGACTCATGGG - Intronic
916863598 1:168832697-168832719 AAGGAGAGGTGTTTCCTAGGTGG + Intergenic
917471350 1:175328533-175328555 ATTGTGTGGTGTTGCCTAGAGGG + Intronic
918327301 1:183422186-183422208 CGTTGGAGGTGGTGCCTAGTGGG + Intergenic
918518099 1:185384721-185384743 AATGGGAGGTGGAGCCAAGATGG - Intergenic
918823139 1:189285408-189285430 GATTGGAGGTGTGGCCTAATAGG - Intergenic
919157342 1:193783178-193783200 GATGAGAGGTATTGTCTAGTGGG + Intergenic
920512400 1:206560726-206560748 AATCTAAGGTGTTGCCTAGATGG + Intronic
921639021 1:217529316-217529338 ATTGGGAGGTGGGGCCTAGTTGG + Intronic
922406816 1:225322957-225322979 CAAGAGAGGAGTTGCCTAGTTGG + Intronic
922579013 1:226683205-226683227 AGGGGGAGGTGTTGCAGAGTTGG - Intronic
924823387 1:247515798-247515820 AATTGGAGGAGGGGCCTAGTGGG - Intronic
924950152 1:248874643-248874665 AATGGCACCTGTTGCCTAGAGGG + Intergenic
1063374417 10:5545558-5545580 AATGGGTGGTGATGCCTACTTGG - Intergenic
1063722804 10:8601474-8601496 GTTGGGAGGTGTGGCCTAGAGGG + Intergenic
1066208405 10:33212517-33212539 ACTGGGAGTTGTTGCTTAATGGG + Intronic
1066339096 10:34512008-34512030 GTTGGGAGGTGTGGCCTAATGGG - Intronic
1066498833 10:35970581-35970603 TGTGGGAGGTGGAGCCTAGTAGG + Intergenic
1067023894 10:42827015-42827037 TGTGGGAGGTGGGGCCTAGTGGG + Intronic
1067580946 10:47445123-47445145 TATTGGAGGTGAGGCCTAGTAGG + Intergenic
1068495400 10:57779555-57779577 ACTGGGAGGTCTTTCCCAGTTGG - Intergenic
1068604349 10:58989071-58989093 AATTGGAGGAGGTGCCCAGTGGG + Intergenic
1068604610 10:58991038-58991060 AATTGGAGGAGTGGCCTGGTGGG + Intergenic
1068631547 10:59303670-59303692 GTTGGGAGGTGGGGCCTAGTGGG + Intronic
1068981561 10:63068352-63068374 AATGGGAGGTGTTGTTCAATGGG + Intergenic
1070144190 10:73761762-73761784 AATGGGAGGTTTGGCCTTTTAGG + Intronic
1070763241 10:79038917-79038939 GGTGGGAGGTGGGGCCTAGTGGG + Intergenic
1071780980 10:88844468-88844490 AATGGGAGGCGTTTACTATTTGG - Intronic
1071978073 10:90975488-90975510 ATTGGGAGATGGGGCCTAGTGGG - Intergenic
1072465411 10:95657779-95657801 ATTGGGAGGTGGGGCCTAATGGG + Intergenic
1073618350 10:105021378-105021400 ATTGGGAGGTGGGGCCTAATGGG - Intronic
1073871983 10:107876167-107876189 AATGGGAGGTCATGCATGGTTGG - Intergenic
1074765232 10:116695314-116695336 AGTGGGAGGTGGGGCCTAATGGG + Intronic
1079301118 11:19279715-19279737 AATGGGAGGTGTTGGGTCATGGG - Intergenic
1079552884 11:21722622-21722644 TGTTGGAGGTGTGGCCTAGTGGG + Intergenic
1080843486 11:36005974-36005996 AATTGGAGGAGGGGCCTAGTAGG - Intronic
1085986155 11:81791291-81791313 TGTAGGAGGTGTGGCCTAGTGGG + Intergenic
1086541050 11:87913607-87913629 ATTGGGAGGTGGGCCCTAGTGGG + Intergenic
1087147509 11:94826715-94826737 ATTGGGAGGTGGGGCCTAGTGGG - Intronic
1087790676 11:102403690-102403712 CTTGGGAGGTGGGGCCTAGTGGG + Intronic
1087882063 11:103428618-103428640 AATGGGAGCTGTTGTTTAATAGG - Intronic
1088124151 11:106403888-106403910 TGTTGGAGGTGGTGCCTAGTAGG + Intergenic
1088939058 11:114435436-114435458 TATTGGAGGTGGTGCCTGGTGGG - Intronic
1089424216 11:118357762-118357784 AATGGGAGTTATTGTCTAATGGG - Intergenic
1089939909 11:122405283-122405305 ATTGGGAGGTGGGGCCTGGTGGG - Intergenic
1091356021 11:134938393-134938415 ACTGGGAGGTGGGGCCTAGTGGG - Intergenic
1092949317 12:13486602-13486624 ATTGGCAGGTTTGGCCTAGTAGG - Intergenic
1093334201 12:17880682-17880704 ATTGGGAGGTAGGGCCTAGTGGG - Intergenic
1094203447 12:27816391-27816413 AATTGGAGGTGGGGCCTGGTGGG - Intergenic
1094456721 12:30643536-30643558 TTTGGGAGGTGGGGCCTAGTGGG + Intronic
1095156087 12:38856548-38856570 AATGGCATGGGTTGCCTAGAGGG + Intronic
1095871240 12:47030514-47030536 AATTGGAGGTGGGGCCTTGTAGG + Intergenic
1096905973 12:54935894-54935916 GTTGGGAGGTGGGGCCTAGTTGG - Intergenic
1097567510 12:61289216-61289238 TATTGGAGGAGGTGCCTAGTGGG - Intergenic
1099259100 12:80354057-80354079 GCTGGGAGGTGTGGCCTAGTGGG + Intronic
1099838432 12:87937031-87937053 GATGGGAGGGGTTGCCTTGAAGG - Intergenic
1100976915 12:100132348-100132370 GTTGGGAGGTGGCGCCTAGTAGG + Intronic
1101214958 12:102572057-102572079 TTTGGGAGGTGGGGCCTAGTGGG + Intergenic
1101703156 12:107194172-107194194 GCTGGAAGGTGGTGCCTAGTGGG - Intergenic
1102622041 12:114203751-114203773 TGTTGGAGGTGGTGCCTAGTGGG + Intergenic
1103962003 12:124614731-124614753 AAAGGGAGATGATCCCTAGTGGG - Intergenic
1105756384 13:23467776-23467798 AAGGCTAGGGGTTGCCTAGTCGG + Intergenic
1106095380 13:26638806-26638828 GTTGGGAGGTATGGCCTAGTGGG + Intronic
1106648666 13:31665312-31665334 CGTTGGAGGTGGTGCCTAGTGGG - Intergenic
1106861307 13:33911823-33911845 ATTGGGAGGTGGGTCCTAGTGGG - Intronic
1107105397 13:36637238-36637260 AATGGGAGGTGTTGCCATGAAGG + Intergenic
1108259042 13:48638716-48638738 ATTGGGAGGTGGGGCCTACTGGG - Intergenic
1108790411 13:53963077-53963099 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
1109549634 13:63876599-63876621 AGTGGGAGGTGAGGCCTGGTGGG + Intergenic
1109620637 13:64900457-64900479 TATTGGAGGTGGGGCCTAGTGGG + Intergenic
1110342165 13:74404244-74404266 AAGGGGTGGTTTTGCATAGTTGG + Intergenic
1110603980 13:77409733-77409755 TATTGGAGGTGGGGCCTAGTAGG - Intergenic
1110607051 13:77445217-77445239 ATTGGGTGGTGGGGCCTAGTGGG - Intergenic
1111066962 13:83106933-83106955 AATGGGAGGGGCTGCCTTGAAGG - Intergenic
1111289172 13:86140830-86140852 AATGGGAGATGTTCCATAGCTGG - Intergenic
1111571130 13:90087668-90087690 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
1111805062 13:93030759-93030781 AATGTGAGGTGGGGCCTGGTGGG + Intergenic
1112710779 13:102126201-102126223 AATGGGAGTTCTTGCTTAATGGG - Intronic
1113488152 13:110670287-110670309 ACTGGGAGGTGTCTCCCAGTTGG - Intronic
1114029055 14:18559403-18559425 AATGAGTGGTGTTGCTTATTAGG + Intergenic
1115013611 14:28582086-28582108 AATGGGAGGTGATAACTAATGGG - Intergenic
1115151130 14:30286930-30286952 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
1115339099 14:32273082-32273104 GGTGGGAGGTCTGGCCTAGTGGG + Intergenic
1115655477 14:35439443-35439465 AATGGGAGGTGTGTCCTATATGG + Intergenic
1115841244 14:37473056-37473078 GCTGGGAGGTGGAGCCTAGTGGG + Intronic
1116750702 14:48879858-48879880 AATGGGAGTTGTTGTTTAATAGG + Intergenic
1116987451 14:51236576-51236598 ATTGGGAGGTGGGGCCTATTGGG - Intergenic
1117077743 14:52121704-52121726 AATGGGAAATGTTGATTAGTTGG - Intergenic
1119750205 14:77071980-77072002 GGTGGGAGGTGGGGCCTAGTGGG - Intergenic
1122526066 14:102385341-102385363 GCTGGGAGGTGGGGCCTAGTAGG - Intronic
1123425041 15:20164063-20164085 TGTGGGAGGTGGGGCCTAGTGGG + Intergenic
1123534266 15:21170596-21170618 TGTGGGAGGTGGGGCCTAGTGGG + Intergenic
1124372767 15:29112839-29112861 AATGGGCGGTGGTGCTTAGTGGG - Intronic
1128930066 15:71696470-71696492 GTTGGGAGGTGGCGCCTAGTGGG - Intronic
1130298209 15:82662078-82662100 AAATGGAGGTGGTGCTTAGTGGG - Intronic
1130467123 15:84198035-84198057 AATGGGAGTTGTTCCATAGCAGG + Intergenic
1130497141 15:84475501-84475523 AATGGGAGTTGTTCCATAGCAGG - Intergenic
1131396906 15:92093456-92093478 TATTGGAGGTGGGGCCTAGTGGG - Intronic
1131724778 15:95209312-95209334 ACTGGCAGGTGTGGCCTAGTGGG - Intergenic
1131920065 15:97316647-97316669 AATTGGAGGTGAGGCCTAATGGG - Intergenic
1132694446 16:1195652-1195674 AATGGGAGGTGTGTTCTAGAGGG + Intronic
1133780560 16:8935884-8935906 ATTGGGAGGTGTTCTCTGGTGGG - Intronic
1134010732 16:10850529-10850551 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
1134745939 16:16588428-16588450 AATGGGAGGTTTTACCATGTCGG + Intergenic
1134868087 16:17626933-17626955 AATTGGAGTTGTTGATTAGTGGG - Intergenic
1134999539 16:18765313-18765335 AATGGGAGGTTTTACCATGTCGG - Intergenic
1135819866 16:25674394-25674416 ATTGGGAGGTGGGACCTAGTGGG + Intergenic
1136504471 16:30694094-30694116 AATGGGAGCTGTTGGCCAGGAGG - Intergenic
1136859817 16:33691682-33691704 TGTGGGAGGTGGGGCCTAGTGGG - Intergenic
1138215369 16:55199998-55200020 GATGGAAGGTGGGGCCTAGTGGG + Intergenic
1138293789 16:55869774-55869796 GAGGGGAGGTGGTGCCTGGTGGG - Intronic
1138312024 16:56033876-56033898 ATTGAGAGGTGGCGCCTAGTAGG - Intergenic
1138849770 16:60613449-60613471 ATTGGGAGGTGTGGCCTTTTGGG - Intergenic
1139087606 16:63606602-63606624 AAAGGGAGGTGTTGGCCAGATGG + Intergenic
1140015586 16:71179621-71179643 AATGGGATGTGTGCCCTGGTTGG + Intronic
1140383612 16:74513363-74513385 ACTGGGAGGTGTCTCCCAGTAGG - Intronic
1203121322 16_KI270728v1_random:1539861-1539883 TGTGGGAGGTGGGGCCTAGTGGG - Intergenic
1144122077 17:12165087-12165109 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
1144938007 17:18915781-18915803 ATTGAGAGGTGGGGCCTAGTGGG - Intronic
1147552440 17:41453676-41453698 AATTGGAGGGGTTGCCTGGGGGG - Intergenic
1148976358 17:51533439-51533461 ATTGGGAGGTGGGGCCTAATGGG + Intergenic
1149359618 17:55880431-55880453 AATGGGAGATGTTGGCTAAAGGG + Intergenic
1149876395 17:60238056-60238078 AATGGAAGGTTTTGGCAAGTAGG - Intronic
1150531177 17:65983468-65983490 AGTGGGAGGTGTTGGCTTATGGG + Intronic
1150769539 17:68029574-68029596 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
1151134715 17:71935120-71935142 AAAGGGAGGTGTTGAGGAGTGGG + Intergenic
1151895463 17:76977538-76977560 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
1154498590 18:14980910-14980932 ATTGGGAGGTGGGGTCTAGTGGG + Intergenic
1155916550 18:31563364-31563386 AATGGGAGGATTGGACTAGTTGG - Intergenic
1156170741 18:34482127-34482149 GTTGGGAGGTGGTGCCTAGTGGG + Intergenic
1157433731 18:47651587-47651609 AAGGGGAGGTCTTGCCTATCTGG - Intergenic
1157448607 18:47767902-47767924 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
1157771890 18:50356219-50356241 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
1157920323 18:51707511-51707533 TTTGGGAGGTGGTGCCTAGGGGG - Intergenic
1158196045 18:54886044-54886066 TGTGGGAGGTGGGGCCTAGTGGG - Intronic
1158203854 18:54969172-54969194 AATTGGAGATGGGGCCTAGTGGG - Intergenic
1158487916 18:57884526-57884548 GTTGGGAGGTGGAGCCTAGTGGG - Intergenic
1159153898 18:64556841-64556863 AATGGGAGGTGATGACTCTTAGG + Intergenic
1159265675 18:66075109-66075131 TGTTGGAGGTGGTGCCTAGTTGG + Intergenic
1162785303 19:13031170-13031192 AATGGGAGCTCTTGACTGGTTGG - Intronic
1163022395 19:14489949-14489971 GTTGGGAGGTGGGGCCTAGTGGG + Intronic
1163429202 19:17256871-17256893 GATGGAAGGTGGTGCCTAGTGGG - Intronic
1163529637 19:17842080-17842102 AATGGGAGGGGTTGAGGAGTGGG - Intronic
1163849514 19:19655281-19655303 AATGGGATGGGGTGCCGAGTGGG - Intronic
1164414316 19:28033595-28033617 AATGGGTGCTGCTGCCTGGTTGG - Intergenic
1167835489 19:52065009-52065031 TATTGGAGGTGGAGCCTAGTGGG - Exonic
926227118 2:10974855-10974877 AGTTGGAGGTGGGGCCTAGTGGG - Intergenic
926612576 2:14961305-14961327 TATTGGAGGTGGGGCCTAGTAGG + Intergenic
926938882 2:18114888-18114910 AATGGGAGGGGCTGCCAAGAAGG - Intronic
927011697 2:18910950-18910972 AATGGGAGGTGTTGGGTCATGGG + Intergenic
927020204 2:19008822-19008844 TATTGGAGGTGGGGCCTAGTAGG + Intergenic
927127952 2:20030506-20030528 CATTGGAGGTGGTGCCTGGTGGG - Intergenic
928750723 2:34467208-34467230 GCTGGGAGGTGTCTCCTAGTAGG - Intergenic
929417808 2:41761433-41761455 TATTGGAGGTGGAGCCTAGTGGG + Intergenic
931263123 2:60637612-60637634 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
932200513 2:69822772-69822794 AATGGGAGTTATTGGTTAGTGGG + Intronic
932375490 2:71231936-71231958 AATGGGGCTTGTTGACTAGTTGG - Intergenic
933167781 2:79094676-79094698 TTTGGGAGGTGATGCCTAGGAGG + Intergenic
933937355 2:87217328-87217350 AGTGGGAGGTGTGGGCTACTGGG + Intergenic
934162895 2:89269166-89269188 ATTGGGAGGTGGGGCCTAATGGG + Intergenic
934204378 2:89913358-89913380 ATTGGGAGGTGGGGCCTAATGGG - Intergenic
934458175 2:94192790-94192812 TGTGGGAGGTGGGGCCTAGTGGG - Intergenic
934892234 2:98080720-98080742 ATTGGGAGGTGGGGCCTAATGGG - Intergenic
936240969 2:110788490-110788512 AATGGGAGTTATTGCTTAATGGG + Intronic
936355785 2:111748474-111748496 AGTGGGAGGTGTGGGCTACTGGG - Intergenic
936548776 2:113416493-113416515 TGTGGGAGGTGGGGCCTAGTTGG - Intergenic
936723199 2:115278784-115278806 TATTGGAGGTGGGGCCTAGTGGG - Intronic
936884199 2:117289636-117289658 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
937615784 2:123920823-123920845 GGTGGGAGGTGGAGCCTAGTGGG - Intergenic
937792518 2:125977696-125977718 AGGGGGAGATGATGCCTAGTAGG + Intergenic
937858418 2:126689493-126689515 GATGGGAGGTGGGACCTAGTGGG + Intronic
937858922 2:126693104-126693126 GATGGGAGGTGGGACCTAGTGGG + Intronic
938021820 2:127912161-127912183 AATTGGAGGTGTGGCCTTTTTGG + Intergenic
938219406 2:129552678-129552700 AACGGGAGGAGTGGCTTAGTGGG - Intergenic
938676634 2:133642270-133642292 ATTGGGAGGTGGTGCCTACTGGG - Intergenic
939243713 2:139595360-139595382 AATTGGAGGTGGGGCCTGGTGGG + Intergenic
939900599 2:147845152-147845174 AATGGGAGCTGCTGCAAAGTTGG + Exonic
940191369 2:151043604-151043626 ATTGGGAGGTAGGGCCTAGTGGG + Intronic
940332799 2:152493499-152493521 GTTGGGAGGTGGAGCCTAGTGGG + Intronic
941140841 2:161779299-161779321 ATTGGGAGGTGGAGCCTAGTGGG - Intronic
941404634 2:165073895-165073917 AGTGGGAAGTGTTGACTGGTTGG + Intergenic
941423004 2:165306259-165306281 AGTGGGAGATGGAGCCTAGTAGG + Intronic
942822558 2:180133023-180133045 AAGGGAAGGTGTGGGCTAGTAGG + Intergenic
943183496 2:184575122-184575144 AATTGGAGGAGGGGCCTAGTGGG - Intergenic
945805857 2:214488943-214488965 AATGGGAGGTGTTGGGTGATGGG - Intronic
946037515 2:216755677-216755699 AATGTGAGGTGTGGCCATGTGGG - Intergenic
946055720 2:216900419-216900441 AGTTGGAGGTGGGGCCTAGTGGG - Intergenic
946875156 2:224122028-224122050 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
947016786 2:225629846-225629868 GTTGGGAGGTGGGGCCTAGTGGG - Intronic
948245652 2:236483020-236483042 AAGGGGAGTTGTTGCTTAATGGG - Intronic
948828252 2:240584766-240584788 GTTAGGAGGTGGTGCCTAGTAGG - Intergenic
1169165114 20:3416003-3416025 AATGGGAGGGGCTGCCAAGAAGG + Intergenic
1169328612 20:4698254-4698276 AATGGGAAGTTTTGCCTTGGTGG - Intronic
1169390746 20:5188944-5188966 ACTGGGAGGTGATGCCTAGTGGG - Intronic
1169616977 20:7458912-7458934 AATGGGAGGTGTTGCATTATGGG + Intergenic
1172178825 20:32988338-32988360 AGTTGGAGGTGCTGCCTGGTAGG + Intronic
1174582876 20:51585039-51585061 AATGGGTATTGTTGCCTAGTAGG - Intergenic
1176238971 20:64067217-64067239 GCTGGGAGGTGTGGCCTAGGAGG + Intronic
1178275953 21:31237126-31237148 AATGGGAGAGGCTGCCCAGTGGG + Intronic
1178786288 21:35656713-35656735 GTTGGGAGGTGGGGCCTAGTGGG + Intronic
1180259171 21:46656028-46656050 GTTGGGAGGTGGGGCCTAGTGGG + Intronic
1180453173 22:15486465-15486487 AATGAGTGGTGTTGCTTATTAGG + Intergenic
1181358033 22:22313637-22313659 TGTGGGAGGTGGGGCCTAGTGGG + Intergenic
1181508370 22:23377044-23377066 GAGGGGAGGTGGTGCCTGGTGGG - Intergenic
1184346340 22:43915810-43915832 ATTGGGAGGTGGGGCCTAATGGG + Intergenic
950412162 3:12846121-12846143 AATGGGAGGGGTTGCCTTGAAGG - Intronic
951033474 3:17907623-17907645 TATTGGAGGTGGGGCCTAGTAGG - Intronic
951368352 3:21812924-21812946 ACTGGGAGGTGTCTCCCAGTTGG - Intronic
951574804 3:24102720-24102742 AATTGGAGGTAGGGCCTAGTCGG + Intergenic
951665141 3:25114537-25114559 AATGGGAGGTGGTGGCAAGTGGG - Intergenic
953560351 3:43985230-43985252 ATTGGGAGGTAGGGCCTAGTGGG + Intergenic
954100001 3:48364240-48364262 AATTGGAGGTGGGGCCTGGTGGG + Intergenic
954558023 3:51533625-51533647 TTTGGGAGGTGGTGCCTAGGAGG + Intergenic
955316252 3:57941576-57941598 GTTGGGAGGTGAAGCCTAGTGGG - Intergenic
955681537 3:61506479-61506501 AATGGGAGCTGTTGGGTAGTGGG + Intergenic
955875569 3:63486850-63486872 TATGGGAGGTTTTTCCCAGTTGG + Intronic
956704957 3:71991662-71991684 AATTGGAGGTGAGGCCTAGTGGG - Intergenic
957285300 3:78209959-78209981 AATGGGAGGTGTTGGATCGTGGG + Intergenic
957462383 3:80538053-80538075 TATTGGAGGTCTGGCCTAGTGGG - Intergenic
957773667 3:84727761-84727783 AATGTGAAGAGTTGGCTAGTTGG - Intergenic
957776378 3:84760627-84760649 AATTGGAGGTGTTCCCCTGTGGG - Intergenic
958017036 3:87950217-87950239 ATTGGGAGGTGGGGCCCAGTGGG - Intergenic
958188009 3:90148116-90148138 AATTGGAGGAGGGGCCTAGTGGG - Intergenic
958863690 3:99474761-99474783 ATTGGGAGATGGGGCCTAGTGGG + Intergenic
959161578 3:102731092-102731114 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
959808956 3:110593471-110593493 AATGGGAGGGGCTGCCTTGAAGG - Intergenic
961582802 3:127896633-127896655 GTTGGGAGGTGGGGCCTAGTAGG - Intergenic
961698389 3:128722712-128722734 TTTGGGAGGTGGGGCCTAGTTGG + Intergenic
962169901 3:133090058-133090080 AATGGAAGGTGGTGGCCAGTGGG + Intronic
963003018 3:140700837-140700859 ACTGGGAGCTGTTGTCTATTGGG + Intronic
963098619 3:141575088-141575110 AATGGGAGGTGGTGGGTAGGAGG + Intronic
963989079 3:151632441-151632463 ATTGAGAGGTGTTGGCCAGTAGG + Intergenic
964414666 3:156434761-156434783 AATGAGAGGTGATAACTAGTGGG + Intronic
964433088 3:156625332-156625354 AATGGGTGGGGCTGCCTAATGGG + Intergenic
964493641 3:157264732-157264754 AATCCAAGGTGTTGCATAGTAGG + Intronic
965429744 3:168571416-168571438 AAAGAGAGGTGTTAACTAGTTGG - Intergenic
965795489 3:172434402-172434424 GTTGGGAGGTGAGGCCTAGTGGG - Intergenic
965872582 3:173279247-173279269 TTTGGGAGGTGGTGCCTAGGAGG - Intergenic
966183910 3:177211355-177211377 GTTGGGAGGTGGTGTCTAGTGGG + Intergenic
966241569 3:177759834-177759856 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
967130300 3:186464619-186464641 CATGGTAGGTGCTCCCTAGTGGG - Intergenic
968238442 3:197052783-197052805 AATGGGAGGTGTGGCGGGGTGGG + Intronic
969966611 4:11003183-11003205 GATTGGAGGTGGTGCCTGGTGGG - Intergenic
970057611 4:11993622-11993644 GATGGGAGGGGTTGCCACGTGGG - Intergenic
970794133 4:19891690-19891712 TTTGGGAGGTGGTGCCTAGGGGG - Intergenic
970978987 4:22075103-22075125 AATGGGAGGGGTTGCCTTGAAGG - Intergenic
972107864 4:35514101-35514123 AATTGGAGGAGGGGCCTAGTGGG + Intergenic
972741327 4:41889517-41889539 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
972815468 4:42640473-42640495 AAAGGGAGGTGGTGACTGGTGGG + Intronic
972977667 4:44657879-44657901 AAAGGGAGTTGTGGCTTAGTGGG + Intronic
973866665 4:55121236-55121258 TATGGAAGGTGTTTCCTATTAGG - Intronic
974006411 4:56561662-56561684 AATGGGAGGTGTTGGGTCATGGG - Intronic
974234143 4:59159494-59159516 AATGGGGGGTGATGCTGAGTGGG + Intergenic
974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG + Intronic
975001578 4:69229598-69229620 ATTGGGAGTTGTTGCTCAGTGGG - Intergenic
975003866 4:69262515-69262537 ATTGGGAGTTGTTGCTCAGTGGG + Intergenic
975175065 4:71279209-71279231 AATGGGAGGTGTTGCTCAAAGGG - Intronic
975500506 4:75079671-75079693 ACTGGGAGGTGTCTCCCAGTTGG + Intergenic
976283397 4:83347199-83347221 GATGGGAGGAGTTGCCTTGAAGG + Intergenic
977186945 4:93950768-93950790 ATTGGGAGGTGGGGCCTAATGGG + Intergenic
977371649 4:96144792-96144814 TATGGGAGGTGTTGAATAGTTGG + Intergenic
977568936 4:98610321-98610343 GATGGGAGGTGGAGCCTAATGGG - Intronic
977691266 4:99914180-99914202 GTTGGGAGGTGTAGCCTAGTGGG - Intronic
978968706 4:114775144-114775166 AATGGGAGGTGTTGTGTCATAGG + Intergenic
979288019 4:118948797-118948819 AACTGGAGGTGGGGCCTAGTGGG - Intronic
979408039 4:120339220-120339242 ATTAGGAGGTGTGGCCTAATGGG - Intergenic
979601664 4:122592308-122592330 AATGGGAGGCGGGGCCTAGTGGG - Intergenic
979776489 4:124594955-124594977 GGTGGGAGGTGGGGCCTAGTAGG + Intergenic
979786556 4:124722194-124722216 TATTGGAGGTGGGGCCTAGTAGG + Intergenic
980585003 4:134801050-134801072 AATGAGAGGTGATGCGTGGTAGG + Intergenic
982086213 4:151839392-151839414 GATGGGAGGTGTTGCCTTTTGGG + Intergenic
982536341 4:156610893-156610915 AATTTCAGGTCTTGCCTAGTAGG - Intergenic
983657298 4:170096303-170096325 ATTGGGAGGTGGAGCCTAATAGG - Intergenic
984810143 4:183788775-183788797 ATTGGGAGGTGGGGCCTAGTGGG - Intergenic
984841604 4:184073262-184073284 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
985062094 4:186090078-186090100 AATGGGAAGTGCTGACTGGTTGG - Intergenic
985184060 4:187296690-187296712 AATGGGAGGTGCTGCCATGAAGG + Intergenic
986250504 5:6053521-6053543 AATTGGACGTGGGGCCTAGTGGG + Intergenic
987228002 5:15863645-15863667 CCTGGGAGGTGGGGCCTAGTGGG + Intronic
987615931 5:20275195-20275217 AATTGGAGGAGGTGCCTAATGGG + Intronic
988657951 5:33233309-33233331 AATGGGAGTTGTTACAGAGTGGG + Intergenic
989414753 5:41160599-41160621 CATGGGAGGTGTTGCTTACTTGG + Intronic
989644840 5:43620061-43620083 ATTGGGAGGTGGGGCCTAGTGGG - Intronic
992356105 5:75985319-75985341 GTTGGGAGGTGGGGCCTAGTAGG - Intergenic
993444185 5:87991184-87991206 ACTGGGAGGCGTCCCCTAGTAGG + Intergenic
993820133 5:92604115-92604137 AATTGGAGGAGGGGCCTAGTGGG - Intergenic
994425310 5:99577350-99577372 AATTGGAGGTGGGGCCTGGTGGG + Intergenic
994436029 5:99734885-99734907 AATTGGAGGTGGGGCCTGGTGGG - Intergenic
994845149 5:104979521-104979543 GTTGGGAGGTGGAGCCTAGTGGG - Intergenic
995274620 5:110263935-110263957 AAAGGCAGATGTTGCCCAGTGGG - Intergenic
995764454 5:115600857-115600879 AATGGGATGTGTGGTCTAGGGGG + Intronic
996239163 5:121172619-121172641 AGTTGGAGGTGAGGCCTAGTGGG - Intergenic
996284212 5:121769891-121769913 CATGGAAGGGGTTGCCTAGAAGG - Intergenic
996676923 5:126186874-126186896 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
996777847 5:127152248-127152270 TTTGGGAGGTGGGGCCTAGTGGG - Intergenic
997570460 5:134923407-134923429 AATGGGAGGTGATTCCTAGGGGG + Intronic
997925704 5:138029292-138029314 AATTGTAGTTGTTGCCTAGAAGG - Intronic
999068404 5:148716483-148716505 GATGGGAGGGGTTGCCTTGAAGG - Intergenic
999742563 5:154567437-154567459 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
1000410719 5:160933345-160933367 GATGGGAGGGGCTGGCTAGTGGG - Intergenic
1000608924 5:163354397-163354419 AATGGGAAATGTTGATTAGTTGG + Intergenic
1000799340 5:165705071-165705093 TATTGGAGGTGGGGCCTAGTGGG + Intergenic
1001171864 5:169427029-169427051 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
1001715487 5:173811653-173811675 TATGGGAGGTGGGGCCTGGTGGG + Intergenic
1002588670 5:180271425-180271447 AATAGGAGGTGTTGGCGATTGGG - Intronic
1003200664 6:3957442-3957464 GGTGGGAGGTGTTTCCTAGGAGG - Intergenic
1003509129 6:6764798-6764820 TATTGGAGGTGTGGCCTAGTGGG + Intergenic
1003721928 6:8713171-8713193 AAGATGAGGTGTTGCCTAGGAGG + Intergenic
1003801790 6:9678453-9678475 AATGGGTGTTGCTGACTAGTTGG + Intronic
1006163615 6:32051932-32051954 AATGGGAGTTCGTGTCTAGTGGG + Intronic
1006870133 6:37243804-37243826 AATGGGTGGTGCTGACTGGTGGG + Intronic
1006989753 6:38204557-38204579 ATTGGGAGGTGATGGCTATTGGG + Intronic
1008113248 6:47516990-47517012 TATGGGAGGTGGGGCCTGGTGGG + Intronic
1009361330 6:62818200-62818222 ACTGGGAGGTGTTTCCCAATTGG + Intergenic
1009804494 6:68585562-68585584 TATTGGAGGTGTGGCCTGGTGGG + Intergenic
1010003387 6:70970525-70970547 ATTGGGAGGTAGGGCCTAGTGGG - Intergenic
1010125039 6:72421648-72421670 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
1010526968 6:76912663-76912685 ATTGGGAGGTGGGGCCTAGTGGG + Intergenic
1010837951 6:80612825-80612847 ACTGGGAGGTGTCTCCCAGTTGG - Intergenic
1010978196 6:82340544-82340566 AATTGGAGGTGGGGCCTGGTGGG - Intergenic
1011264454 6:85500386-85500408 CATTGGAGGTGGGGCCTAGTAGG + Intergenic
1011830498 6:91365525-91365547 TATGGGAGCTCTGGCCTAGTTGG + Intergenic
1012532220 6:100251646-100251668 AATGGGAGGTAAGGCCTAATGGG + Intergenic
1013120578 6:107137187-107137209 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
1013469918 6:110454084-110454106 GTTGGGAGGTGAGGCCTAGTGGG - Intronic
1013844272 6:114430672-114430694 GCTGGGAGGTGAGGCCTAGTGGG + Intergenic
1015589814 6:134812422-134812444 GTTGGGAGGTGGGGCCTAGTAGG + Intergenic
1018418201 6:163619838-163619860 AATTGGAGGAGGGGCCTAGTGGG - Intergenic
1018515039 6:164570202-164570224 TGTGGGAGGTGGGGCCTAGTGGG - Intergenic
1018724803 6:166603622-166603644 AATGACAGGTGTTGCCCAGGTGG - Intronic
1019875784 7:3809342-3809364 TATGGGAGGTGGGGCCTGGTGGG - Intronic
1019965354 7:4494289-4494311 TGTGGGAGGTGGGGCCTAGTTGG - Intergenic
1020198788 7:6063134-6063156 TATTGGAGGTGGGGCCTAGTGGG + Intergenic
1021306581 7:19039667-19039689 ACTGGGAGGTGTCTCCCAGTTGG + Intronic
1022170462 7:27823755-27823777 AATGGGAGTTGTTGTTTAATGGG - Intronic
1022706602 7:32807700-32807722 AATGGCTCTTGTTGCCTAGTTGG - Intergenic
1023476853 7:40589568-40589590 ATTGGGAGGTGGGGCCTAATGGG - Intronic
1024186448 7:46952864-46952886 AGTGGCAGGTGAGGCCTAGTGGG - Intergenic
1024440971 7:49417067-49417089 ATTTGGAGGTGGGGCCTAGTGGG - Intergenic
1025104578 7:56160696-56160718 ATTGGGAGGTGAAGCCTAGAGGG - Intergenic
1025952749 7:66158349-66158371 ATTGGGAGGTGGGGCCTAATGGG + Intergenic
1026548135 7:71342411-71342433 TGTGGGAGGTGGGGCCTAGTGGG - Intronic
1027582372 7:80014739-80014761 ATTAGGAGGTGGTACCTAGTGGG - Intergenic
1027711047 7:81601752-81601774 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
1028494821 7:91450894-91450916 AATGGGAGGTTCTGCCTGGCAGG + Intergenic
1028745354 7:94320719-94320741 GATGGGAGGTGCTGCCTTGAAGG + Intergenic
1030072647 7:105711201-105711223 AATTGGAGGAGGGGCCTAGTGGG - Intronic
1030345144 7:108424457-108424479 AAAGGGATGTGTTGCCTATCAGG + Intronic
1030752294 7:113242576-113242598 AATTGGAGGTGGGGCCTGGTGGG + Intergenic
1032883388 7:136114272-136114294 ACTGGGAGGTGTCTCCCAGTTGG + Intergenic
1033661142 7:143403178-143403200 GATGGGAGGTTTTGCCTTGTTGG - Intronic
1034878485 7:154745869-154745891 CATGGGAGGTGGGGTCTAGTGGG - Intronic
1035057814 7:156047964-156047986 AAGGGGAGTTCTTGCTTAGTGGG + Intergenic
1035178719 7:157073779-157073801 GTTGGGAGGTGGAGCCTAGTGGG - Intergenic
1036571299 8:9982026-9982048 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
1037783149 8:21885126-21885148 AATGGGAGTTGTTGCTTAATGGG + Intergenic
1038257968 8:25968537-25968559 AATGGGAGTTGTTGTTTAATGGG + Intronic
1038509137 8:28114635-28114657 TATTGGAGGTGTGGCCTGGTGGG - Intronic
1038569523 8:28648591-28648613 AATTGGAAGTGGTGCATAGTGGG - Intronic
1040906012 8:52470419-52470441 GCTGGGAGGTGGGGCCTAGTGGG + Intergenic
1040947357 8:52897485-52897507 GTTGGGAGGTGGGGCCTAGTAGG - Intergenic
1042158379 8:65867790-65867812 TTTGGGAGGTGGTGCCTAGGAGG - Intergenic
1042856272 8:73271282-73271304 GTTGGGAGGTGAGGCCTAGTGGG + Intergenic
1043483335 8:80674681-80674703 GTTGGGAGGTGGGGCCTAGTGGG - Intronic
1044268520 8:90211828-90211850 GTTGGGAGGTGGAGCCTAGTGGG - Intergenic
1044956564 8:97487571-97487593 ACTGGGAGGTGTCTCCCAGTTGG + Intergenic
1045194025 8:99911840-99911862 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
1045421754 8:102023266-102023288 AATGGCCAGTGTTGCCTAGTTGG - Intronic
1045423435 8:102039740-102039762 GTTGGGAGGTGGGGCCTAGTGGG + Intronic
1046822036 8:118644277-118644299 AATGGGAGGTGTTGTGTCATGGG + Intergenic
1047185662 8:122630916-122630938 ATTGGGAGGTGGGGCCTAATGGG - Intergenic
1047209762 8:122831909-122831931 CTTGGGAGGTGGTGCCTAGCGGG + Intronic
1048077313 8:131085816-131085838 GCTGGGAGGTGGAGCCTAGTGGG + Intergenic
1049831672 8:144704875-144704897 AGTGGGAGGTGTTGCCAGGCAGG + Intergenic
1049904219 9:200681-200703 TGTGGGAGGTGAGGCCTAGTTGG + Intergenic
1051058133 9:13012240-13012262 GTTGGGAGGTGAGGCCTAGTGGG - Intergenic
1052359841 9:27541714-27541736 AAGGGGAGGGGATGGCTAGTGGG + Intergenic
1053084323 9:35204997-35205019 AATGGGAGGTGATGGATAATGGG + Intronic
1053459671 9:38258556-38258578 ATTGGGAGGTGGGGCCTAATGGG - Intergenic
1053688683 9:40568595-40568617 TGTGGGAGGTGGGGCCTAGTGGG - Intergenic
1053747174 9:41210658-41210680 TGTGGGAGGTGGGGCCTAGTTGG + Intergenic
1054275350 9:63062462-63062484 TGTGGGAGGTGGGGCCTAGTGGG + Intergenic
1054299924 9:63369506-63369528 TGTGGGAGGTGGGGCCTAGTGGG - Intergenic
1054399481 9:64702469-64702491 TGTGGGAGGTGGGGCCTAGTGGG - Intergenic
1054433062 9:65186734-65186756 TGTGGGAGGTGGGGCCTAGTGGG - Intergenic
1054480110 9:65654702-65654724 TGTGGGAGGTGGGGCCTAGTTGG - Intergenic
1054497321 9:65834941-65834963 TGTGGGAGGTGGGGCCTAGTGGG + Intergenic
1054681169 9:68220624-68220646 TGTGGGAGGTGGGGCCTAGTTGG - Intergenic
1055055769 9:72022416-72022438 TATGGGAGGTGAAGCCTGGTGGG + Intergenic
1056371338 9:85957544-85957566 GTTGGGAGGTGAGGCCTAGTGGG - Intronic
1056995064 9:91448545-91448567 GTTGGGAGGTGGGGCCTAGTGGG - Intergenic
1057300311 9:93874745-93874767 GATGGGAGGTGCTGCCATGTAGG + Intergenic
1058397696 9:104574008-104574030 AATTGGAGGAAGTGCCTAGTGGG + Intergenic
1058531249 9:105906838-105906860 TATTGGAGGTGGGGCCTAGTGGG - Intergenic
1058920377 9:109608875-109608897 ATTGGGAGGTATGGCCTAATGGG - Intergenic
1059275490 9:113093199-113093221 AATGGGAGATGTTGGTCAGTAGG + Intergenic
1061634059 9:131894810-131894832 GTTGGGAGGTGGGGCCTAGTGGG + Intronic
1202783307 9_KI270718v1_random:21437-21459 TGTGGGAGGTGGGGCCTAGTTGG + Intergenic
1202630877 M:15367-15389 AATGGGAGGTGATTCCTAGGGGG - Intergenic
1186145114 X:6617084-6617106 CATTGGAGGTGGGGCCTAGTGGG + Intergenic
1186557314 X:10573527-10573549 ATTGGGAGGAGGGGCCTAGTGGG - Intronic
1186701010 X:12090143-12090165 AATTGGAGGTGAGGCCTGGTGGG + Intergenic
1187101371 X:16196355-16196377 ATTGGGAGGTAGTGCCTCGTGGG + Intergenic
1187133750 X:16527177-16527199 AATGGGTGCTGTTGCTTGGTTGG - Intergenic
1187548849 X:20281203-20281225 AATGGGAGTTGCTGTTTAGTGGG - Intergenic
1187647367 X:21363273-21363295 AATGGGGAGTTTTGCCTAATGGG - Intergenic
1187947532 X:24441103-24441125 AAGGGGAGTTGTTGTCTAATGGG - Intergenic
1187948067 X:24445922-24445944 ATTGGGAGGTGTGGCCTTTTGGG - Intergenic
1188528203 X:31108461-31108483 GTTGGGAGGCGTGGCCTAGTGGG + Intronic
1188979022 X:36709622-36709644 AATGGCAGGTGTTGCATGGGTGG + Intergenic
1190076058 X:47318032-47318054 AATGGGAAGTTTTAACTAGTGGG - Intergenic
1190151120 X:47949474-47949496 ATTGGGAGGTGGGGCCTAATGGG + Intronic
1190369191 X:49725538-49725560 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
1191971910 X:66826246-66826268 TATTGGAGGTGAGGCCTAGTGGG + Intergenic
1192273990 X:69611428-69611450 CATTGGAGGTGGTGCCTAATGGG + Intergenic
1192843655 X:74882880-74882902 AATGGGAGGCGCCCCCTAGTAGG + Intronic
1193699773 X:84746905-84746927 AATGGGAAGTGTGGCTTAATTGG - Intergenic
1193739922 X:85204390-85204412 AATGGGAGGAGTGGCCAAGATGG - Intergenic
1193795957 X:85873640-85873662 AATGGGAGGTGATCACTAATTGG + Intronic
1194048175 X:89034942-89034964 TGTTGGAGGTGTGGCCTAGTGGG - Intergenic
1195478906 X:105320404-105320426 AATGTGTGCAGTTGCCTAGTAGG - Intronic
1195647334 X:107247117-107247139 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
1195861308 X:109386293-109386315 AATGGGAGGAGGTGCTTATTAGG + Intronic
1196015915 X:110939737-110939759 GTTGGGAGGTGGGGCCTAGTGGG + Intergenic
1196315223 X:114214114-114214136 TATTGGAGGTGTGGCCTGGTGGG - Intergenic
1197144801 X:123159627-123159649 AATGGGAGGTGTTGGGTCATGGG - Intergenic
1197314933 X:124954178-124954200 AATGGTAGGAGTCACCTAGTAGG - Intronic
1197973637 X:132141441-132141463 ATTGAGAGGTGGGGCCTAGTGGG + Intergenic
1197983083 X:132238831-132238853 GCTGGGAGGTGTGGCCTAATGGG - Intergenic
1198171087 X:134105789-134105811 TGTTGGAGGTGGTGCCTAGTGGG + Intergenic
1198293648 X:135263235-135263257 ACTGGGAGGTGTCTCCCAGTTGG + Intronic
1199741596 X:150740969-150740991 AATGGGAGGTGTTGGGTCATGGG - Intronic
1199778957 X:151040856-151040878 ACTGGGAGGTGTCTCCCAGTTGG + Intergenic
1201504091 Y:14678697-14678719 AATGGGGGCTGTTGTCTAGCAGG + Intronic