ID: 974874406

View in Genome Browser
Species Human (GRCh38)
Location 4:67685646-67685668
Sequence GGGAGGTGTTGCCTAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3873
Summary {0: 1, 1: 3, 2: 68, 3: 535, 4: 3266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874399_974874406 -3 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266
974874394_974874406 26 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266
974874401_974874406 -4 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266
974874395_974874406 25 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266
974874397_974874406 -2 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874406 Original CRISPR GGGAGGTGTTGCCTAGTGGG AGG Intronic
Too many off-targets to display for this crispr