ID: 974874407

View in Genome Browser
Species Human (GRCh38)
Location 4:67685654-67685676
Sequence TTGCCTAGTGGGAGGTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3637
Summary {0: 1, 1: 11, 2: 257, 3: 1271, 4: 2097}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874399_974874407 5 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874407 4:67685654-67685676 TTGCCTAGTGGGAGGTGTTTAGG 0: 1
1: 11
2: 257
3: 1271
4: 2097
974874401_974874407 4 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874407 4:67685654-67685676 TTGCCTAGTGGGAGGTGTTTAGG 0: 1
1: 11
2: 257
3: 1271
4: 2097
974874403_974874407 -9 Left 974874403 4:67685640-67685662 CCTAATGGGAGGTGTTGCCTAGT 0: 1
1: 2
2: 8
3: 113
4: 1058
Right 974874407 4:67685654-67685676 TTGCCTAGTGGGAGGTGTTTAGG 0: 1
1: 11
2: 257
3: 1271
4: 2097
974874397_974874407 6 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874407 4:67685654-67685676 TTGCCTAGTGGGAGGTGTTTAGG 0: 1
1: 11
2: 257
3: 1271
4: 2097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874407 Original CRISPR TTGCCTAGTGGGAGGTGTTT AGG Intronic
Too many off-targets to display for this crispr