ID: 974874409

View in Genome Browser
Species Human (GRCh38)
Location 4:67685662-67685684
Sequence TGGGAGGTGTTTAGGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20705
Summary {0: 93, 1: 1068, 2: 3098, 3: 6930, 4: 9516}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874397_974874409 14 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874409 4:67685662-67685684 TGGGAGGTGTTTAGGTCATGAGG 0: 93
1: 1068
2: 3098
3: 6930
4: 9516
974874403_974874409 -1 Left 974874403 4:67685640-67685662 CCTAATGGGAGGTGTTGCCTAGT 0: 1
1: 2
2: 8
3: 113
4: 1058
Right 974874409 4:67685662-67685684 TGGGAGGTGTTTAGGTCATGAGG 0: 93
1: 1068
2: 3098
3: 6930
4: 9516
974874401_974874409 12 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874409 4:67685662-67685684 TGGGAGGTGTTTAGGTCATGAGG 0: 93
1: 1068
2: 3098
3: 6930
4: 9516
974874399_974874409 13 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874409 4:67685662-67685684 TGGGAGGTGTTTAGGTCATGAGG 0: 93
1: 1068
2: 3098
3: 6930
4: 9516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874409 Original CRISPR TGGGAGGTGTTTAGGTCATG AGG Intronic
Too many off-targets to display for this crispr