ID: 974874410

View in Genome Browser
Species Human (GRCh38)
Location 4:67685663-67685685
Sequence GGGAGGTGTTTAGGTCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14816
Summary {0: 51, 1: 536, 2: 1995, 3: 4419, 4: 7815}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874403_974874410 0 Left 974874403 4:67685640-67685662 CCTAATGGGAGGTGTTGCCTAGT 0: 1
1: 2
2: 8
3: 113
4: 1058
Right 974874410 4:67685663-67685685 GGGAGGTGTTTAGGTCATGAGGG 0: 51
1: 536
2: 1995
3: 4419
4: 7815
974874399_974874410 14 Left 974874399 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 974874410 4:67685663-67685685 GGGAGGTGTTTAGGTCATGAGGG 0: 51
1: 536
2: 1995
3: 4419
4: 7815
974874397_974874410 15 Left 974874397 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 974874410 4:67685663-67685685 GGGAGGTGTTTAGGTCATGAGGG 0: 51
1: 536
2: 1995
3: 4419
4: 7815
974874401_974874410 13 Left 974874401 4:67685627-67685649 CCGTTACGTAGGACCTAATGGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 974874410 4:67685663-67685685 GGGAGGTGTTTAGGTCATGAGGG 0: 51
1: 536
2: 1995
3: 4419
4: 7815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874410 Original CRISPR GGGAGGTGTTTAGGTCATGA GGG Intronic
Too many off-targets to display for this crispr