ID: 974876621

View in Genome Browser
Species Human (GRCh38)
Location 4:67710545-67710567
Sequence CCCGGGAAGTTGCTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974876613_974876621 22 Left 974876613 4:67710500-67710522 CCCCCGGAAGCTCATGTTCTACC No data
Right 974876621 4:67710545-67710567 CCCGGGAAGTTGCTTCTCACTGG No data
974876615_974876621 20 Left 974876615 4:67710502-67710524 CCCGGAAGCTCATGTTCTACCAT No data
Right 974876621 4:67710545-67710567 CCCGGGAAGTTGCTTCTCACTGG No data
974876614_974876621 21 Left 974876614 4:67710501-67710523 CCCCGGAAGCTCATGTTCTACCA No data
Right 974876621 4:67710545-67710567 CCCGGGAAGTTGCTTCTCACTGG No data
974876617_974876621 1 Left 974876617 4:67710521-67710543 CCATTTTGTCTCTTAATGCACAT 0: 36
1: 99
2: 202
3: 325
4: 600
Right 974876621 4:67710545-67710567 CCCGGGAAGTTGCTTCTCACTGG No data
974876616_974876621 19 Left 974876616 4:67710503-67710525 CCGGAAGCTCATGTTCTACCATT No data
Right 974876621 4:67710545-67710567 CCCGGGAAGTTGCTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974876621 Original CRISPR CCCGGGAAGTTGCTTCTCAC TGG Intergenic
No off target data available for this crispr