ID: 974882487

View in Genome Browser
Species Human (GRCh38)
Location 4:67776905-67776927
Sequence CTGAGACGGACTGAGACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974882487_974882493 20 Left 974882487 4:67776905-67776927 CCAGCTGTCTCAGTCCGTCTCAG No data
Right 974882493 4:67776948-67776970 CTCTTCTGACAGCCTGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974882487 Original CRISPR CTGAGACGGACTGAGACAGC TGG (reversed) Intergenic
No off target data available for this crispr