ID: 974882493

View in Genome Browser
Species Human (GRCh38)
Location 4:67776948-67776970
Sequence CTCTTCTGACAGCCTGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974882487_974882493 20 Left 974882487 4:67776905-67776927 CCAGCTGTCTCAGTCCGTCTCAG No data
Right 974882493 4:67776948-67776970 CTCTTCTGACAGCCTGCTCTAGG No data
974882489_974882493 -4 Left 974882489 4:67776929-67776951 CCCCAGATAACAGCAGTGCCTCT No data
Right 974882493 4:67776948-67776970 CTCTTCTGACAGCCTGCTCTAGG No data
974882486_974882493 28 Left 974882486 4:67776897-67776919 CCTCTAATCCAGCTGTCTCAGTC No data
Right 974882493 4:67776948-67776970 CTCTTCTGACAGCCTGCTCTAGG No data
974882488_974882493 6 Left 974882488 4:67776919-67776941 CCGTCTCAGTCCCCAGATAACAG No data
Right 974882493 4:67776948-67776970 CTCTTCTGACAGCCTGCTCTAGG No data
974882490_974882493 -5 Left 974882490 4:67776930-67776952 CCCAGATAACAGCAGTGCCTCTT No data
Right 974882493 4:67776948-67776970 CTCTTCTGACAGCCTGCTCTAGG No data
974882491_974882493 -6 Left 974882491 4:67776931-67776953 CCAGATAACAGCAGTGCCTCTTC No data
Right 974882493 4:67776948-67776970 CTCTTCTGACAGCCTGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974882493 Original CRISPR CTCTTCTGACAGCCTGCTCT AGG Intergenic
No off target data available for this crispr