ID: 974887635

View in Genome Browser
Species Human (GRCh38)
Location 4:67840072-67840094
Sequence TGTTAAGTCTAGGTTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974887630_974887635 20 Left 974887630 4:67840029-67840051 CCTCTAGAATGTCTGACAGATGT 0: 1
1: 0
2: 1
3: 12
4: 123
Right 974887635 4:67840072-67840094 TGTTAAGTCTAGGTTGTACAGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974887635 Original CRISPR TGTTAAGTCTAGGTTGTACA GGG Intronic
903460781 1:23519243-23519265 TATTATTTCTAAGTTGTACAAGG - Intronic
904762431 1:32815491-32815513 GGTTAAGACTAAGTTGTAAATGG + Intronic
908689370 1:66760467-66760489 TGTTAAGTCCAGGTTGACTAGGG + Intronic
909388812 1:75093617-75093639 TTTTAAGTCTAGGTCATAAAAGG + Intergenic
909954088 1:81756060-81756082 TGATAAGACTGGGTTGTATATGG - Intronic
911867066 1:103042059-103042081 TTTTAATTCTAACTTGTACAAGG + Intronic
913930299 1:124952295-124952317 TTTTAAGCCTATGTTGTAAAAGG - Intergenic
916434752 1:164767541-164767563 TGTTAACTCTCAGTTGCACAAGG + Intronic
917490282 1:175492926-175492948 TGTTAATTCTAGGTAGTGGATGG + Intronic
919040232 1:192377867-192377889 TGTTATGTGTAGCTTGTAGAGGG - Intergenic
1068946152 10:62730982-62731004 TGTTAAATCTAGGTGGTTGATGG - Intergenic
1071935728 10:90528019-90528041 AGTTAAGTCTAGTTTGCAAATGG + Intergenic
1073743754 10:106441730-106441752 CCTTAAGTCTGGGCTGTACATGG - Intergenic
1074344432 10:112669148-112669170 TGTTAACTCTTGTTTGGACAGGG + Intronic
1075011609 10:118875141-118875163 TGTTAAGGCCAGGTTGGCCATGG - Intergenic
1077820450 11:5733119-5733141 TGTGAAGACCAGATTGTACATGG - Intronic
1079943232 11:26708625-26708647 GGTTAATTATAGGTTGTACATGG + Intronic
1082181703 11:49127830-49127852 TGATATGTTTAGGTTGTAAAAGG + Intergenic
1084554306 11:69866748-69866770 TGTTAGGCCCAGATTGTACAGGG + Intergenic
1086683793 11:89707011-89707033 TGATATGTTTATGTTGTACAAGG - Intergenic
1087775461 11:102252735-102252757 TGTTAAGTGGAAGTTGTCCAGGG + Intergenic
1088204766 11:107379407-107379429 GGTTAAGTCTTTGTTGTAGAAGG - Intronic
1088640575 11:111869278-111869300 TGTTAAGTGTAGGTTGTTTAAGG - Intronic
1091250960 11:134143812-134143834 TGTTAGGTCTTTGTTGTATATGG + Intronic
1092548385 12:9471288-9471310 TGAGAAGTCTAGGATATACAGGG + Intergenic
1094504616 12:31051161-31051183 TGAGAAGTCTAGGATATACAGGG - Intergenic
1095822037 12:46488762-46488784 TGTGAAGTATAGGTGATACAAGG - Intergenic
1096285120 12:50293272-50293294 GCTTAAGTCTAGGTTGTAGGAGG + Intergenic
1096596767 12:52700868-52700890 TGTCAAGTATAGGCTATACAGGG + Intronic
1097547495 12:61023172-61023194 TGTTAAGTCTAGTTGTTCCAGGG + Intergenic
1097564986 12:61256391-61256413 TGTTAAGTCTAGCTTGTTTAGGG - Intergenic
1098883213 12:75937558-75937580 TGTTGAGTCTGAGTTGTCCAAGG + Intergenic
1100112203 12:91259511-91259533 TGTCAAGTGAAGGTTGTACTGGG - Intergenic
1100658617 12:96673459-96673481 TATTAATTATAGGTTTTACATGG + Intronic
1108554131 13:51576519-51576541 TGTAAAATTTAGTTTGTACATGG + Intergenic
1119596007 14:75934573-75934595 GCTTAAGTCTAGGTTGAATATGG + Intronic
1121075809 14:91067270-91067292 TGAGAAGTTTAGGTGGTACATGG + Intronic
1126104844 15:45140914-45140936 GGATAAGTCCTGGTTGTACAGGG - Exonic
1128820700 15:70650166-70650188 TGCTAAAACTGGGTTGTACAAGG + Intergenic
1130194459 15:81766223-81766245 TGATAACTTTAGGTTGTAAAGGG - Intergenic
1143561493 17:7698439-7698461 TGTTAAGTCTAGGCCGGGCATGG + Intronic
1153526746 18:6002640-6002662 TGTTAAGTGTATAATGTACATGG + Intronic
1153653487 18:7261944-7261966 TGTTAAGTCTAGCGGGAACAGGG - Intergenic
1157932359 18:51837034-51837056 TCTTAAGTCTGGGTTGTTTAGGG - Intergenic
1162603267 19:11686959-11686981 GGTTAAGTCTAGGTTCTACTTGG + Intergenic
929513241 2:42582374-42582396 TTTTAAGTTTATGTTGTAAATGG + Intronic
933890232 2:86761604-86761626 TATTAAGACTAAATTGTACAAGG - Intronic
936280022 2:111130728-111130750 TGCTAAGTGTAGGTTTTATATGG + Intronic
937156089 2:119720084-119720106 TGTTAATTCTAGGCTGGGCACGG - Intergenic
948512091 2:238475305-238475327 TGTTTAGTCTAGCAGGTACATGG + Intergenic
1170882685 20:20311013-20311035 TGTCCAGTGTAGGTTCTACATGG - Intronic
1172543249 20:35738427-35738449 TGTTAAGTCTAGAGTTTAAAAGG + Intronic
1175672641 20:60919226-60919248 TGTTCAGGCTACGTTGTCCACGG - Intergenic
1177276499 21:18918998-18919020 TGATAAGTCTTGGGTGAACATGG + Intergenic
1178568320 21:33709994-33710016 TGTTAGATGTAGGTTGTTCATGG + Intronic
1184184519 22:42856201-42856223 TTTTAAGTCTTGATGGTACAGGG - Intronic
951600097 3:24364644-24364666 TATTATGTCTTGTTTGTACATGG - Intronic
956700369 3:71953488-71953510 TTTTGAGGCTAGGTTGTAAAAGG + Intergenic
957001254 3:74887696-74887718 TGTTAGGTATAGGTTTTTCATGG + Intergenic
957959330 3:87228415-87228437 TGTTTAGTCTAGGTTGTTGCTGG + Intronic
961669013 3:128514467-128514489 TGTTAACTGTAGGTTCTTCATGG + Intergenic
970422154 4:15915391-15915413 TCCTAAGTCGAGGTTGTACCTGG + Intergenic
972796899 4:42430306-42430328 TGTTAAGAATAGTATGTACAGGG - Intronic
973195544 4:47435525-47435547 TTTTAAATCTAGGTTCTACAGGG + Intergenic
974887635 4:67840072-67840094 TGTTAAGTCTAGGTTGTACAGGG + Intronic
979652124 4:123147181-123147203 TGTCATGTCTTGGTTGTGCATGG + Intronic
979963233 4:127046497-127046519 TGGTATGTCTAGGTTGCCCAAGG - Intergenic
980627883 4:135397969-135397991 TATTGAGTCTAGTTTGTAAAAGG + Intergenic
982861810 4:160461550-160461572 TCTTAAGTCTAAATTCTACAGGG - Intergenic
983061018 4:163161158-163161180 TTTTAATTCTAGCTTATACATGG - Intronic
988941225 5:36150272-36150294 TGTTCAGTCTTGGTTTTACTAGG - Intronic
991052666 5:62289630-62289652 TAATAAGCCTAGGTTATACAAGG - Intergenic
991992000 5:72348913-72348935 TGGGAAGTCTAGGATGCACAGGG + Intronic
993714607 5:91263258-91263280 TGTTAGCTCTAGGTTTTCCACGG - Intergenic
997802689 5:136882188-136882210 TGTTAAGTCTGTGTTCTTCAAGG - Intergenic
1002221307 5:177684759-177684781 CTTTAAGTGTAGGTTGTACTTGG + Intergenic
1002879810 6:1241309-1241331 TGTTAAGTATAGTATGTAAATGG + Intergenic
1002885136 6:1286733-1286755 TGTTCAGGGTAGGTTGCACAGGG + Intergenic
1002964860 6:1954231-1954253 TTTTTAGTTAAGGTTGTACAGGG - Intronic
1007667264 6:43522299-43522321 TTTTAAGACTAGGTTGAAAAAGG + Intronic
1011319040 6:86069654-86069676 TCTAGAGTCTAGGTTCTACATGG - Intergenic
1019979118 7:4608001-4608023 TGTTGAATCTAGATTGTACCTGG + Intergenic
1024123627 7:46269912-46269934 TGTTTAGTCTAGCTTGGACCTGG + Intergenic
1026351677 7:69521922-69521944 TGTTAAGTCTAGTTGGTTTATGG + Intergenic
1027769977 7:82394128-82394150 TATTAACTCTAGGTTGAAAATGG + Intronic
1031547842 7:123071527-123071549 TGTTAAGCCTACGTAGTAAATGG - Intergenic
1038066769 8:23971584-23971606 TGTTTAGTCAAGGCAGTACAAGG - Intergenic
1038985250 8:32802009-32802031 TGTTGAGTCTAAGGTGCACAAGG - Intergenic
1039581356 8:38669411-38669433 TGTTATGTTTAGTTTCTACAGGG + Intergenic
1044188925 8:89290544-89290566 TTTTAAGTCTATGTTCTTCAGGG - Intergenic
1047774118 8:128055080-128055102 TGTTAAGTCTAAATTCTACAGGG - Intergenic
1052070775 9:24079136-24079158 TCTCAAGGCCAGGTTGTACAAGG - Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1056753962 9:89371081-89371103 TGTTATGTCTGGGGTGTATAAGG + Intronic
1056753979 9:89371149-89371171 TGTTATGTCTGGGGTGTATAAGG + Intronic
1186662140 X:11679477-11679499 TCCTAAGGCTAGGTTGTATAAGG + Intergenic
1188544838 X:31293696-31293718 TTTTAAGACAAGGTTGTTCAGGG + Intronic