ID: 974891857

View in Genome Browser
Species Human (GRCh38)
Location 4:67893029-67893051
Sequence ATAACCAGCTTAACTTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974891857_974891858 -7 Left 974891857 4:67893029-67893051 CCTATCAAAGTTAAGCTGGTTAT No data
Right 974891858 4:67893045-67893067 TGGTTATTATCATTACCAGCTGG No data
974891857_974891860 5 Left 974891857 4:67893029-67893051 CCTATCAAAGTTAAGCTGGTTAT No data
Right 974891860 4:67893057-67893079 TTACCAGCTGGGAATGTGTCAGG No data
974891857_974891863 16 Left 974891857 4:67893029-67893051 CCTATCAAAGTTAAGCTGGTTAT No data
Right 974891863 4:67893068-67893090 GAATGTGTCAGGCCTGAAGAGGG No data
974891857_974891862 15 Left 974891857 4:67893029-67893051 CCTATCAAAGTTAAGCTGGTTAT No data
Right 974891862 4:67893067-67893089 GGAATGTGTCAGGCCTGAAGAGG No data
974891857_974891859 -6 Left 974891857 4:67893029-67893051 CCTATCAAAGTTAAGCTGGTTAT No data
Right 974891859 4:67893046-67893068 GGTTATTATCATTACCAGCTGGG No data
974891857_974891864 19 Left 974891857 4:67893029-67893051 CCTATCAAAGTTAAGCTGGTTAT No data
Right 974891864 4:67893071-67893093 TGTGTCAGGCCTGAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974891857 Original CRISPR ATAACCAGCTTAACTTTGAT AGG (reversed) Intergenic
No off target data available for this crispr