ID: 974896607

View in Genome Browser
Species Human (GRCh38)
Location 4:67947828-67947850
Sequence ATAAGGCACCTGGACAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974896601_974896607 7 Left 974896601 4:67947798-67947820 CCTTGTTCATCTTTTTACCGCTA 0: 1
1: 0
2: 0
3: 15
4: 144
Right 974896607 4:67947828-67947850 ATAAGGCACCTGGACAGAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 143
974896603_974896607 -10 Left 974896603 4:67947815-67947837 CCGCTAAGACCCAATAAGGCACC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 974896607 4:67947828-67947850 ATAAGGCACCTGGACAGAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974896607 Original CRISPR ATAAGGCACCTGGACAGAGT AGG Intronic
900672638 1:3865435-3865457 AAAAGGCTCCAGGAGAGAGTAGG + Intronic
906598618 1:47104418-47104440 GCAAGCCACCTGGAAAGAGTTGG - Intronic
907535722 1:55154225-55154247 ATAAGGCTACTGGGCAGGGTTGG + Exonic
907857784 1:58321007-58321029 CTAAGTCACCTGGGCAGAGCTGG - Intronic
913100353 1:115558342-115558364 AACAGGTACCTGGACAGCGTTGG + Intergenic
915442314 1:155952690-155952712 AAAAGGCCCCTGGGCAGGGTGGG + Exonic
922208621 1:223470128-223470150 GTAAGGGACCTGTGCAGAGTGGG - Intergenic
922424770 1:225482536-225482558 AAGAGGCAGCTGGTCAGAGTTGG - Intergenic
1062972029 10:1655231-1655253 ATAAGGCACTAGAACAGAGGGGG + Intronic
1066020707 10:31297885-31297907 AGAAGGTACGTGGACAGAGAAGG + Intergenic
1066371622 10:34822427-34822449 ATAGGGTAACTTGACAGAGTGGG - Intergenic
1068919988 10:62473297-62473319 GTAAGGAACCTGGGCAAAGTTGG + Intronic
1078172347 11:8937922-8937944 ATAAGGCATCGGGAAAGAGAAGG + Exonic
1087176290 11:95099193-95099215 ATAAGGCACCAGGTTAGAGCTGG + Intronic
1087224525 11:95583167-95583189 ATAACGCAGCTTGACAGTGTTGG - Intergenic
1087588013 11:100147219-100147241 ATAAGCCAGCTGCACAGAGATGG - Intronic
1087946428 11:104165073-104165095 AAAGGGCAACAGGACAGAGTGGG + Intergenic
1088904350 11:114143028-114143050 ATAAAGCCCCTGGCCAGCGTTGG + Intronic
1089159234 11:116424750-116424772 AGAAGCCACCTGGATAGAGAGGG + Intergenic
1090411435 11:126512436-126512458 GTAGGGCACCAGGACAGAGGTGG + Intronic
1090940993 11:131388209-131388231 TTAAGCCACCGGGACAGAGGAGG + Intronic
1091127424 11:133113199-133113221 ATAAGGCAGATGGAAAGAGATGG - Intronic
1091388666 12:111724-111746 CTGAGACACCTGGACAGAGTGGG + Intronic
1096076936 12:48811808-48811830 ATCAGGCCTCTGGACAGACTGGG - Intergenic
1096085172 12:48860848-48860870 ATGAGTCACCTGGAGAGAGGTGG - Intronic
1096504987 12:52087112-52087134 AGAGGGCACCTGAGCAGAGTTGG - Intergenic
1104546259 12:129715577-129715599 ATAACCCACCTGTACAGGGTGGG + Intronic
1107421476 13:40251353-40251375 ATAAAGCACATGAACATAGTAGG - Intergenic
1107869383 13:44732999-44733021 AGAAGCCACCGGGAGAGAGTTGG - Intergenic
1109958000 13:69593380-69593402 GTAAGCCACGTGGACAGAGATGG - Intergenic
1111537496 13:89622853-89622875 ACATGGCACATGGCCAGAGTGGG + Intergenic
1116226516 14:42160584-42160606 ATAGAGCTCCTGGAAAGAGTGGG - Intergenic
1117373309 14:55098415-55098437 ATGTGGCACATGGCCAGAGTTGG - Intergenic
1117509816 14:56439431-56439453 ATAAGCCACCTCGATCGAGTGGG - Intergenic
1119092274 14:71795746-71795768 AGAAGGCACCTTGACAGAAAGGG + Intergenic
1119626984 14:76186225-76186247 AGGAGGCATTTGGACAGAGTTGG + Intronic
1120568053 14:86083633-86083655 AAAAGACATCTGGACAGAGGAGG - Intergenic
1121400040 14:93667806-93667828 ATAGGGCCTCTTGACAGAGTTGG + Intronic
1123125017 14:105940330-105940352 ATAAGGCCCCGGGACGGAGATGG + Intergenic
1127298114 15:57627600-57627622 ATAATGAAAGTGGACAGAGTGGG - Intronic
1131266750 15:90920009-90920031 AGAAGGCCCTTGGTCAGAGTGGG + Exonic
1133094612 16:3434137-3434159 AGAAGGCACTTGGACAGAATGGG - Exonic
1134229398 16:12417334-12417356 GAAAGACACCTGGACAGAGGCGG - Intronic
1137363515 16:47841264-47841286 ATAAGGGAACTGGACAGGTTGGG - Intergenic
1137553403 16:49455501-49455523 AGAGGGCACCAGAACAGAGTGGG - Intergenic
1139445454 16:66995518-66995540 CCAAGGCACCTGGAAAGAGAGGG - Intronic
1141336439 16:83159786-83159808 ATAATGCACCTGGGCACGGTGGG + Intronic
1141504545 16:84466473-84466495 ATAAGACACCAGGACGAAGTGGG + Intergenic
1142034578 16:87855337-87855359 AGAAGGCACCTGAACAGGGAGGG + Intronic
1143795057 17:9329753-9329775 AAATGGCAACTGGACAGAGTTGG + Intronic
1146422064 17:32696491-32696513 ATGAGGAACCTTGACAGAATGGG + Intronic
1147241203 17:39091531-39091553 GGAAAGCAGCTGGACAGAGTGGG + Intronic
1148103946 17:45109394-45109416 ATGTGGCACCTGGGCACAGTGGG - Exonic
1149322862 17:55499118-55499140 AAAAGACACCAGGACAGAGTTGG - Intergenic
1150166110 17:62945146-62945168 ATAAGGCACCTGGAAAAGGATGG - Intergenic
1152139890 17:78530101-78530123 ATCTGGCACCCGGACAGAGCAGG + Intronic
1160971104 19:1768135-1768157 ATGGGGCCCCTGGACAGAGCAGG + Intronic
1161838313 19:6662944-6662966 ATGAGGAACCTGGACCCAGTTGG - Intronic
1162084200 19:8238596-8238618 AGCAGGCACCAGGCCAGAGTTGG + Intronic
1162685839 19:12383560-12383582 ATCAGGAACCTGGACTGTGTAGG - Exonic
1163270483 19:16250329-16250351 ATAAGGCCCCTGGCCAAACTGGG + Intergenic
1164735990 19:30541174-30541196 ATAAGGCACCTGGATGGGGCCGG - Intronic
1165129045 19:33621172-33621194 ACACAGCACCGGGACAGAGTAGG - Intergenic
1165510241 19:36262466-36262488 ATAAGGGAACTGGGCAGAGGGGG + Intergenic
1168660806 19:58164552-58164574 ATCAGCCACCTGGAGAGACTGGG + Intergenic
928019192 2:27688141-27688163 ACTAGGCCCCTGGACAAAGTTGG + Intronic
930443900 2:51446470-51446492 AAAAAGAACATGGACAGAGTTGG - Intergenic
937687566 2:124715123-124715145 ACAAGGCAGCTGAACTGAGTGGG + Intronic
938737371 2:134198580-134198602 ATAAGGAACATGGACAGAGTAGG - Intronic
939881935 2:147640918-147640940 ATAAGGCAGCTGGGAAGAATAGG + Intergenic
940089218 2:149897233-149897255 ATAAGCCACCTGGGCAGAGGAGG - Intergenic
942138598 2:172954919-172954941 ATAAGGTACCTGGCCAAAATGGG - Intronic
943613337 2:190061309-190061331 AACAGGCACCTTGACAGAGAAGG - Intronic
944621021 2:201516403-201516425 ACAAGGCAGCAGGAGAGAGTGGG + Intronic
948427003 2:237894718-237894740 AAAAGCCACCTGGACAGCCTGGG - Intronic
948707940 2:239806849-239806871 ATGGGGCACGTGGACAGAGCGGG + Intergenic
1169282339 20:4278373-4278395 ATAAGGCAGATGGAAACAGTGGG - Intergenic
1169676896 20:8164503-8164525 AAATGGCACCTGGACACAGGTGG - Intronic
1172049777 20:32108350-32108372 GAAAGGCACCTGGAGAGAGAGGG - Intergenic
1172448970 20:35008422-35008444 ATAAGGCACCAGCACAGAACAGG + Intronic
1173597955 20:44271963-44271985 TTCAGGAACCTGGACAGAGGTGG + Intronic
1178213261 21:30562273-30562295 ATAAGGCAGCTGGGCATTGTGGG - Intergenic
1178802121 21:35805906-35805928 ACAAGGCTGCTGTACAGAGTAGG - Intronic
1182037992 22:27214314-27214336 AACAGGCACTTGGAAAGAGTTGG - Intergenic
1184958775 22:47913442-47913464 ATAAGGAACCTATACAGGGTTGG + Intergenic
950218430 3:11176396-11176418 ATGAGGCATCTGGAAATAGTGGG - Intronic
953532698 3:43752668-43752690 AGAAAGCCCCTGGACAGGGTGGG + Intergenic
953725603 3:45395207-45395229 CTAAGGCAGCAGAACAGAGTTGG - Intronic
954601393 3:51873276-51873298 CTAAGGCAGCAGGAAAGAGTTGG + Intergenic
956063063 3:65368262-65368284 GCAAGGCACATGGACAGATTAGG + Intronic
959564786 3:107823403-107823425 ATATGGCACCTTGGCATAGTAGG + Intergenic
960723635 3:120648874-120648896 ATTTGGCACCTGGACACATTGGG + Intronic
968944653 4:3657290-3657312 ATTAGGCACCTGTGCAGAGAGGG - Intergenic
969086345 4:4659454-4659476 AAAAGGCACCTGGAGAGATGGGG + Intergenic
969174280 4:5386817-5386839 AGAAGTCACGTGGATAGAGTCGG + Intronic
970286153 4:14518670-14518692 ATAAGGCTCATGGACACTGTAGG - Intergenic
973829305 4:54742460-54742482 CTAAGGCACCTGGGCTCAGTTGG - Intergenic
974896607 4:67947828-67947850 ATAAGGCACCTGGACAGAGTAGG + Intronic
975990020 4:80249352-80249374 ATATGACACATGGACAGAATGGG - Intergenic
983278225 4:165644729-165644751 AAAAGGCAGCTGGTCAGAGCGGG - Intergenic
985016118 4:185637670-185637692 ATCAGGCACCTGGAGAGTGCGGG - Intronic
985350370 4:189055091-189055113 ATAAGGCAGCTGGAGAGTGGAGG - Intergenic
989112547 5:37920700-37920722 ACAAGGGATCTGGCCAGAGTAGG - Intergenic
989160645 5:38387407-38387429 AAAAGGCTCCTGGAGACAGTTGG - Intronic
992082654 5:73249595-73249617 AAAAAGCACCTGTACATAGTAGG - Intergenic
994638292 5:102370991-102371013 ATTAAGCACCAGGACTGAGTAGG + Intergenic
996892619 5:128440428-128440450 AGCAGGCACCTGGCCAGAGCAGG + Intronic
997392775 5:133530755-133530777 ACAAGGCACATTGACAGAGGAGG + Intronic
997879135 5:137574053-137574075 AGGAGGGACCTGGCCAGAGTTGG - Intronic
1000166504 5:158654473-158654495 ATAACTCACCTGGAGACAGTTGG - Intergenic
1001182420 5:169533001-169533023 CTAAGGCACCTGTACACAGGTGG - Intergenic
1003154435 6:3579119-3579141 CTAAGCCACCTGGAAAGAGTGGG + Intergenic
1004170909 6:13294923-13294945 ATGAGGCACTTGTACAGTGTGGG + Intronic
1005381259 6:25236596-25236618 ATACTTCACCTGGCCAGAGTAGG - Intergenic
1008892894 6:56515743-56515765 ACAGTACACCTGGACAGAGTGGG + Intronic
1013633928 6:112010635-112010657 ATGAGGCACCAGAACAGAGAAGG + Intergenic
1016481585 6:144487686-144487708 CTAAGTCACCTGGTAAGAGTTGG + Exonic
1017905148 6:158752890-158752912 ATAAAGCACTTGGCCACAGTAGG - Intronic
1018845210 6:167551221-167551243 TTAAGGAACCTGTCCAGAGTGGG - Intergenic
1019690627 7:2409180-2409202 ATGATGCACCTGGGCAGAGAAGG + Intronic
1021883542 7:25116211-25116233 CTAAGTCACCTGCACTGAGTTGG - Intergenic
1022394676 7:29976160-29976182 AAAATGCTCCTGGACAGCGTTGG - Intronic
1023873217 7:44273774-44273796 AAAAAGGACATGGACAGAGTTGG - Intronic
1024352118 7:48377033-48377055 TAAAGGCAGCTGGACAGGGTGGG + Intronic
1024938699 7:54739883-54739905 ACAAGGCACCGGGACACACTAGG + Intergenic
1029728835 7:102426098-102426120 AGAAGGCACCTGCAGAGAGCAGG + Exonic
1030896009 7:115060652-115060674 ATAAGCCACTTGGACACAGCTGG - Intergenic
1031003635 7:116446895-116446917 ATAAGACACCTTGGCAGAGGTGG - Intronic
1031486857 7:122337309-122337331 ATGAGGCACCTGGACATATGTGG - Intronic
1031903649 7:127437634-127437656 ACAAGACACCTGAAAAGAGTAGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1033906300 7:146208720-146208742 ATGAAACACCAGGACAGAGTTGG + Intronic
1036966886 8:13308869-13308891 AGAAGGGACCTGGATAGATTTGG + Intronic
1037940813 8:22949381-22949403 AGAAGGCACCGGGCCAGAGCTGG - Intronic
1042628946 8:70794699-70794721 ATAAGACACCTGGAATAAGTAGG - Intergenic
1042992769 8:74658855-74658877 AGAAGGCCACTGGACAAAGTAGG + Intronic
1044312509 8:90710211-90710233 AAAAAGCACCTTGACAGAATTGG - Intronic
1044900803 8:96942399-96942421 AGAAGGCAACTGGGCAGAGCTGG - Intronic
1048354458 8:133641851-133641873 CTAAGACACGTGGACAGAGGGGG - Intergenic
1048885996 8:138910409-138910431 ATGAGGCACCAGGACACAGAGGG - Intronic
1051142518 9:13993100-13993122 TTAAGGCACCTTGACACAGTTGG - Intergenic
1051213025 9:14765485-14765507 ATAAAGCACCTGTACACAGTGGG + Intronic
1053346664 9:37383306-37383328 AAAAGGCAGCTGGTCAGAGAAGG + Intergenic
1054827911 9:69591207-69591229 AAGAGGCACCTGGAGAGAGGGGG - Intronic
1061147518 9:128808599-128808621 ATAAGGCACCCCAACAGAGAAGG - Exonic
1187365013 X:18659675-18659697 ATATGGCACCTGGACACACAAGG + Intronic
1189203729 X:39219902-39219924 CTAAGGCAGCTGGACTGAGCAGG - Intergenic
1197288678 X:124627580-124627602 ATAAGGGACATGGACAGAGGTGG - Intronic
1198446303 X:136719163-136719185 ATCAAGCAACTGGATAGAGTTGG + Intronic
1198596704 X:138243792-138243814 TTAAGCCACCTGGATAGACTGGG + Intergenic
1199587294 X:149429284-149429306 AGCAGCAACCTGGACAGAGTTGG + Intergenic
1199948914 X:152689905-152689927 TGCTGGCACCTGGACAGAGTTGG - Intergenic
1199960762 X:152778544-152778566 TGCTGGCACCTGGACAGAGTTGG + Intergenic
1200420518 Y:2960497-2960519 ATATTGCACCAGGACAAAGTGGG + Intronic