ID: 974896870

View in Genome Browser
Species Human (GRCh38)
Location 4:67950599-67950621
Sequence ACCGGAGGGGGGAATCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974896858_974896870 22 Left 974896858 4:67950554-67950576 CCTAGATTAGAGTTTGACTGAAT 0: 1
1: 4
2: 68
3: 169
4: 417
Right 974896870 4:67950599-67950621 ACCGGAGGGGGGAATCTTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974896870 Original CRISPR ACCGGAGGGGGGAATCTTGG GGG Intronic
900074458 1:801799-801821 ACAGGACTGGGGAGTCTTGGAGG + Intergenic
901399366 1:9005518-9005540 AGCGGGGGTGGGAAGCTTGGAGG - Intronic
902596106 1:17510399-17510421 ATAGGTGGGGTGAATCTTGGCGG + Intergenic
903477106 1:23627144-23627166 ACCGGCGGGGGGAACCTGGCAGG - Intronic
903849943 1:26300105-26300127 ACCGGAGGAGGGAATTGAGGTGG - Intronic
905492785 1:38357677-38357699 CCTGGAGGGGGAAATTTTGGGGG - Intergenic
907871792 1:58450262-58450284 ACACGATGGGGGAATCCTGGAGG - Intronic
909723953 1:78811360-78811382 ACAAGAGGTGGAAATCTTGGGGG - Intergenic
910448267 1:87320573-87320595 CCCGAGGAGGGGAATCTTGGGGG + Intergenic
912532478 1:110336210-110336232 AGGGGAGGGGGTAATTTTGGGGG + Intergenic
912594635 1:110861932-110861954 ACTGGAGGGTGGAGTCTGGGAGG - Intergenic
912793357 1:112674740-112674762 AACGGAGGAGGGAAGCCTGGTGG + Intronic
913997295 1:143661820-143661842 ACCGGAGAGGGGCAGCTTGCCGG - Intergenic
914193665 1:145432041-145432063 ACCGGAGAGGCGCATCTTGCCGG - Intergenic
914375772 1:147072619-147072641 ACCGGAGAGGCGCATCTTGCTGG + Intergenic
914474994 1:148014931-148014953 ACCGGAGAGGCGCATCTTGCCGG - Intergenic
918661654 1:187095775-187095797 ACTTGAGGGGGCAATCTAGGTGG - Intergenic
922270304 1:224026703-224026725 ACAGGACTGGGGAGTCTTGGAGG + Intergenic
922271906 1:224043163-224043185 AAGGGAGGGGGGAGTGTTGGAGG - Intergenic
922271942 1:224043261-224043283 AGGGGAGGGGGGAGTGTTGGAGG - Intergenic
922271976 1:224043348-224043370 ACGGAAGGGGGGAGTGTTGGAGG - Intergenic
922271998 1:224043408-224043430 AGGGGAGGGGGGAGTGTTGGAGG - Intergenic
922272026 1:224043486-224043508 AGGGGAGGGGGGAGTGTTGGAGG - Intergenic
922272049 1:224043544-224043566 AGGGGAGGGGGGAGTGTTGGAGG - Intergenic
922272065 1:224043584-224043606 AGGGGAGGTGGGAATGTTGGAGG - Intergenic
924132418 1:240925272-240925294 ACTGGTGGGGGGAATGATGGAGG - Intronic
1063375825 10:5553701-5553723 ACCGGCGGGGGCCATCGTGGGGG - Intergenic
1065351566 10:24800176-24800198 ACAGGAAGGGGTATTCTTGGAGG - Intergenic
1067361506 10:45584613-45584635 ACCAGGGGCAGGAATCTTGGAGG - Intronic
1069922645 10:71826135-71826157 ACAGGAGGGTGGAATCTTTAAGG - Intronic
1072190025 10:93071258-93071280 ATGGGTGGGGGGAACCTTGGAGG + Intergenic
1072822937 10:98576296-98576318 AGGGGAGGGGTGAATCTTTGAGG + Intronic
1073100180 10:101002370-101002392 ACTTGAAGGGGGAGTCTTGGTGG + Exonic
1073543096 10:104328174-104328196 ACCGGAGATGGGAATCCTGGAGG - Intronic
1074895384 10:117773060-117773082 ACTGGAGGTGGGAAATTTGGGGG - Intergenic
1076264432 10:129098736-129098758 CCCAAAGGTGGGAATCTTGGGGG + Intergenic
1077418414 11:2436626-2436648 ACTGGGGGTGGGAAGCTTGGCGG + Intergenic
1079325464 11:19487386-19487408 ACCCGAGGGGTGAATACTGGAGG - Intronic
1081047638 11:38296312-38296334 ACAGGAGGGGGGACGCGTGGGGG + Intergenic
1082175171 11:49049913-49049935 ACCGGAGGAGGGCATCCTGGAGG - Intergenic
1085088601 11:73690651-73690673 ACCGGAGGGTGGTAACTTGCTGG + Intronic
1085744524 11:79103240-79103262 AGGGGAGGGGGGAGTCCTGGAGG - Intronic
1086690596 11:89786171-89786193 ACCGGAGGAGGGCGTCCTGGAGG + Intergenic
1086715203 11:90053489-90053511 ACCGGAGGAGGGCGTCCTGGAGG - Intergenic
1086889348 11:92238419-92238441 ATCGGAGGGGGCAATCTGGTTGG + Intergenic
1086956268 11:92937257-92937279 AAGGGAGGAGGGAAGCTTGGAGG + Intergenic
1098301040 12:69054391-69054413 ACCAGAGAAGGAAATCTTGGTGG - Intergenic
1101591755 12:106131093-106131115 ACCAGAGGTTGGAATCTTAGAGG + Intronic
1108284187 13:48889883-48889905 TTAGGAGGTGGGAATCTTGGAGG - Intergenic
1112917454 13:104569209-104569231 AAAGGAGGAGGCAATCTTGGAGG - Intergenic
1113533357 13:111045364-111045386 ACGGGAGTGGGGAATCTTCATGG + Intergenic
1114487149 14:23069621-23069643 ACAGGAGGGGGGAGTGGTGGTGG + Intronic
1118215037 14:63800804-63800826 ACTTGAGGGTGGAATCTGGGAGG + Intergenic
1118634780 14:67737610-67737632 ACCATAGGAGGGAATCTGGGTGG + Intronic
1119034406 14:71217493-71217515 ACTGGGTGAGGGAATCTTGGGGG + Intergenic
1122499359 14:102186533-102186555 ACCGGAGGGGGGTGTTGTGGGGG - Intronic
1126561848 15:50052567-50052589 ACCCGATGGGCCAATCTTGGAGG - Intronic
1137791718 16:51180608-51180630 ACAGAAGAGGAGAATCTTGGGGG - Intergenic
1143687453 17:8529480-8529502 AATGGACGGGGGAAGCTTGGAGG - Intronic
1144062916 17:11599142-11599164 TCCGGAGGGAGGGATCTGGGTGG + Intronic
1145052550 17:19674357-19674379 ACCTGAGGGAGGCTTCTTGGGGG - Intronic
1146079046 17:29760962-29760984 AACGGTGGGGGGATTCATGGAGG - Intronic
1146132703 17:30292202-30292224 CCCGGAGGCGGGAACCTAGGGGG - Intergenic
1150239679 17:63621956-63621978 ACGGGAGGTGGGAATGTGGGCGG + Intergenic
1150703859 17:67470398-67470420 ACAGGAGTGGGGAATGTGGGGGG - Intronic
1151035134 17:70789927-70789949 ACAGGAGATGGGAAACTTGGGGG + Intergenic
1153509702 18:5838445-5838467 ACCCGAGGAGGGAGTCATGGGGG + Intergenic
1159505419 18:69329057-69329079 ACCTGAGGGTGGAATATGGGAGG + Intergenic
1160520690 18:79506360-79506382 ACCGGAGGTGGGAAGATGGGGGG - Intronic
1161388626 19:4009795-4009817 CTCGGAGGGGCGAATGTTGGGGG + Intronic
1162570050 19:11466363-11466385 ACAGGAAGGTGGAAACTTGGTGG - Intronic
1163000796 19:14365524-14365546 TCAGGAGGTGGGAATCATGGAGG - Intergenic
1168071389 19:53954124-53954146 CCAGGCGGTGGGAATCTTGGAGG + Intergenic
929711413 2:44270706-44270728 ACCCGCGGGGCCAATCTTGGGGG - Intergenic
936265183 2:110999527-110999549 TCAGGAGGTGGGATTCTTGGGGG - Intronic
937016152 2:118607789-118607811 GCAGGAGGGGGGACTCTTGAGGG + Intergenic
937089246 2:119194886-119194908 ACAGCAAGGGGGAATTTTGGGGG + Intergenic
945306733 2:208266224-208266246 AACAGAGGGCGGAGTCTTGGGGG + Intergenic
945333004 2:208561117-208561139 ACAGTAGGTGGGAATCTTGGGGG + Intronic
945431280 2:209769041-209769063 ACAGGACATGGGAATCTTGGGGG + Intergenic
946652635 2:221910270-221910292 ACCGGGGGTGGGTATCTTTGGGG - Intergenic
947810529 2:233001164-233001186 TCCGGAAGGGGGAATCTGGTTGG - Intronic
948662309 2:239515105-239515127 ACCGGAGGGAGGCAGCTTGCTGG - Intergenic
948818386 2:240525596-240525618 ACAGGAGGGAGGAGGCTTGGTGG + Intronic
1172902168 20:38343380-38343402 ACCGAAGGGAGGAATCAAGGAGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1177296464 21:19182656-19182678 AGTGGAGCTGGGAATCTTGGAGG - Intergenic
1181524490 22:23472411-23472433 ACTGGAGGGTGGAAGTTTGGAGG + Intergenic
1183407633 22:37638326-37638348 ACCTGAGTGTGGAATCCTGGTGG - Intronic
1184196702 22:42934645-42934667 AACGGTGGGGGGCTTCTTGGAGG - Intronic
954150512 3:48654909-48654931 AGAGGAGAGGGGAATCTTGGTGG + Intronic
957250958 3:77770651-77770673 ACAGGAGTGGGCAATTTTGGGGG + Intergenic
961715265 3:128853450-128853472 ACCTGAGAGGGGGATCTTGTGGG - Intergenic
961814961 3:129544658-129544680 ACCTGAGGGAGGACTCCTGGGGG + Intronic
963883483 3:150554210-150554232 AACGGAGGGGGGATTTTTCGGGG - Intronic
964196217 3:154067898-154067920 ACCGAAGGGGGGCATTTTAGAGG - Intergenic
970507176 4:16743376-16743398 ACCAGGGGTGGGAATCTTGGAGG - Intronic
974896870 4:67950599-67950621 ACCGGAGGGGGGAATCTTGGGGG + Intronic
975983613 4:80184321-80184343 AGCGGAAGGGGGCATCTTTGCGG - Intronic
984485066 4:180357833-180357855 ATAGGAGTGGGGAATATTGGGGG + Intergenic
984673397 4:182518261-182518283 CCCAGGGGTGGGAATCTTGGGGG - Intronic
986731147 5:10635922-10635944 GCCGCAGCGGGGAATCCTGGAGG + Intronic
988966727 5:36426065-36426087 ACCTGAGGGTGGAGTTTTGGAGG - Intergenic
991052113 5:62284392-62284414 ACAGGAGGTGAGAATCTTTGGGG - Intergenic
997975501 5:138439398-138439420 ACTGGAGGGGGGAATATTAGGGG + Intronic
1002169457 5:177367122-177367144 AGCGGAGGGGGCAAATTTGGAGG + Intronic
1004197407 6:13517151-13517173 CCAGGACGGTGGAATCTTGGTGG + Intergenic
1004335583 6:14761656-14761678 ACTGGAGGGGGGAAGGTGGGAGG + Intergenic
1006707371 6:36032456-36032478 ACAGAAGGGGAGAATCTTTGTGG + Intronic
1006952340 6:37833337-37833359 ACAGGAAGAGGGATTCTTGGGGG - Intronic
1014415523 6:121178585-121178607 CCAGGAGGTGGGGATCTTGGGGG - Intronic
1014701002 6:124687855-124687877 ACTGGAGAGAGGAATCATGGGGG + Intronic
1014784845 6:125607199-125607221 AGCAGAAGGAGGAATCTTGGAGG - Intergenic
1022924927 7:35047095-35047117 ACCTGAAGGAGGAATCTGGGTGG + Intergenic
1024809160 7:53187305-53187327 ACCGTAGGGAGGGATCTTGAGGG + Intergenic
1029822938 7:103161800-103161822 ACCTGAAGGAGGAATCTGGGTGG + Intergenic
1035541186 8:439680-439702 ACAGGACTGGGGAGTCTTGGAGG - Intronic
1037761571 8:21745255-21745277 TCCTGCAGGGGGAATCTTGGTGG - Intronic
1039854137 8:41398102-41398124 TCCGAAGGGAGGAAGCTTGGTGG - Intergenic
1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG + Intergenic
1040789236 8:51205770-51205792 ATTGGTGGGGGGCATCTTGGAGG + Intergenic
1045984024 8:108226813-108226835 AACTGAGGGAGGAATCATGGGGG - Intronic
1051626291 9:19102712-19102734 ACCGTAGGGAGGGATCTTGAGGG - Exonic
1060172874 9:121476152-121476174 ATCTGAGAGGGGAATCTTGATGG + Intergenic
1203778769 EBV:88824-88846 GGGGGAGGGGGGAATCTTGTTGG - Intergenic
1186605590 X:11086904-11086926 ACCAGGAGAGGGAATCTTGGAGG + Intergenic
1188880320 X:35484422-35484444 ACTGGAGGGTGGAGTCTGGGAGG - Intergenic
1189385718 X:40535157-40535179 TCTGGGGGTGGGAATCTTGGGGG + Intergenic
1189898306 X:45679469-45679491 ACCTGAGGGTGGAATGTGGGAGG + Intergenic
1191716100 X:64194606-64194628 AGCAGATGGGGGAATCTGGGAGG + Intronic
1197617612 X:128712443-128712465 ACCTGAGGGGGTAATGTTGACGG - Intergenic
1199164194 X:144650527-144650549 ACCAGAGGGGGGAAGCATAGTGG + Intergenic
1200715593 Y:6539621-6539643 ACCAGAGAGGTGTATCTTGGGGG - Intergenic