ID: 974900363

View in Genome Browser
Species Human (GRCh38)
Location 4:67988995-67989017
Sequence ACTCATAGTTGAGGCTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974900363_974900367 4 Left 974900363 4:67988995-67989017 CCATTTCAGCCTCAACTATGAGT No data
Right 974900367 4:67989022-67989044 GGTGGCCCCTTTTCCACTAGTGG No data
974900363_974900374 28 Left 974900363 4:67988995-67989017 CCATTTCAGCCTCAACTATGAGT No data
Right 974900374 4:67989046-67989068 CTGGCGCCACTAGAGGAAGAAGG No data
974900363_974900373 21 Left 974900363 4:67988995-67989017 CCATTTCAGCCTCAACTATGAGT No data
Right 974900373 4:67989039-67989061 TAGTGGACTGGCGCCACTAGAGG No data
974900363_974900375 29 Left 974900363 4:67988995-67989017 CCATTTCAGCCTCAACTATGAGT No data
Right 974900375 4:67989047-67989069 TGGCGCCACTAGAGGAAGAAGGG No data
974900363_974900369 9 Left 974900363 4:67988995-67989017 CCATTTCAGCCTCAACTATGAGT No data
Right 974900369 4:67989027-67989049 CCCCTTTTCCACTAGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974900363 Original CRISPR ACTCATAGTTGAGGCTGAAA TGG (reversed) Intergenic
No off target data available for this crispr