ID: 974903154

View in Genome Browser
Species Human (GRCh38)
Location 4:68025703-68025725
Sequence GTCACAGCCCAGATACTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974903154_974903159 13 Left 974903154 4:68025703-68025725 CCACCAAGTATCTGGGCTGTGAC No data
Right 974903159 4:68025739-68025761 CAGAAAATAATTATTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974903154 Original CRISPR GTCACAGCCCAGATACTTGG TGG (reversed) Intergenic
No off target data available for this crispr