ID: 974905554

View in Genome Browser
Species Human (GRCh38)
Location 4:68051013-68051035
Sequence TAATCTCTGTGCAGTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974905554_974905556 8 Left 974905554 4:68051013-68051035 CCATCAGGACTGCACAGAGATTA No data
Right 974905556 4:68051044-68051066 CTTATTTATTGTCAGCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974905554 Original CRISPR TAATCTCTGTGCAGTCCTGA TGG (reversed) Intergenic