ID: 974907816

View in Genome Browser
Species Human (GRCh38)
Location 4:68078838-68078860
Sequence TTTCCATCACTCAGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974907816 Original CRISPR TTTCCATCACTCAGGGAACA GGG Intronic
905764392 1:40587995-40588017 TTTCTAAGATTCAGGGAACAGGG - Intergenic
909671814 1:78197805-78197827 TTTTCATCTTTCAGGGACCATGG + Intergenic
910100005 1:83565503-83565525 TTTCCATCATGCAGAGAACTAGG + Intergenic
910269627 1:85379906-85379928 TTGCAATCATTCAGGCAACAGGG - Intronic
910383146 1:86652176-86652198 TTTGTATCACTCAGGGTACCTGG - Intergenic
910516448 1:88066590-88066612 TGTCCATCATTCAGGAAAAAGGG - Intergenic
913478428 1:119261295-119261317 TTTGAATCACTTGGGGAACAGGG - Intergenic
914420263 1:147522471-147522493 TTCCCATCACTCAGGCTTCAGGG - Intergenic
915871039 1:159559854-159559876 ATACCATCACTCAGGGATCCTGG - Intergenic
918456833 1:184728970-184728992 TTTCCACAAATCAGGGAAGAAGG + Intronic
920064177 1:203254351-203254373 TTTTCATGTCTCAGGGAATAGGG - Intronic
920803591 1:209211540-209211562 TTGTCATCACTCAGGGGATATGG + Intergenic
921754139 1:218833794-218833816 TTTCCTTCACTTGGGGAACATGG - Intergenic
922206821 1:223455345-223455367 TTTCCTTCACTTAGGGAGGAAGG - Intergenic
924417175 1:243868908-243868930 CTTCCATCACTCTAGGAAGAGGG - Intergenic
1065406149 10:25367971-25367993 TTTCCATGATCCAGGCAACAGGG - Intronic
1069781045 10:70955679-70955701 TTGGCATCACTCAGGCAACAAGG - Intergenic
1070024809 10:72622444-72622466 ATTCCATCACTCTGGCCACAGGG + Intronic
1072983855 10:100122372-100122394 TCTCCATCACGGAGGGAGCAAGG - Intergenic
1074971963 10:118546163-118546185 TTTCAAGCATTAAGGGAACATGG + Intergenic
1075825057 10:125348923-125348945 TGTCCTTCAATCAGGGGACAAGG - Intergenic
1078048759 11:7943448-7943470 TTTGCATGACTCAGGGGACTGGG - Intergenic
1079020145 11:16903530-16903552 TTGCCAACACTCAGGGATTATGG + Intronic
1082016921 11:47496317-47496339 TCTCCATACCTCAGGGAAGAAGG - Intronic
1083033624 11:59616012-59616034 TTTCCAGCGCTCAGGGAGGACGG + Exonic
1084648125 11:70472642-70472664 TTTCTATCACACATGGGACAAGG - Intronic
1086600303 11:88625217-88625239 TCTACCTCACTCAGAGAACAGGG + Intronic
1090199002 11:124840441-124840463 TTCCCATCCCACAGGGAACGCGG - Intergenic
1090341227 11:126022451-126022473 TTTCTATTACTCCAGGAACATGG + Intronic
1090389324 11:126377784-126377806 TTTCTACCAATTAGGGAACAAGG + Intronic
1091828009 12:3529297-3529319 TTGTCATCTCTCAGGGATCATGG + Intronic
1092440676 12:8499042-8499064 CTTCCATCACTCAGATCACATGG + Intergenic
1095800410 12:46266478-46266500 TTTCCATAATTGAGGGAAGAAGG - Intronic
1098360770 12:69652322-69652344 GTTCCAGGACTCAGGGAAAAAGG + Intronic
1099156521 12:79183427-79183449 TTGCCACAACTCAGGGAAAAGGG + Intronic
1099780942 12:87194416-87194438 ATGCCATCACTCAGGGACCTAGG + Intergenic
1101523436 12:105505826-105505848 TGTCCACCACTGAGGCAACAGGG + Intergenic
1101848519 12:108383351-108383373 TTTGCAGCATCCAGGGAACAGGG + Intergenic
1102016561 12:109651704-109651726 TTTCCATGACCCAGGGGATATGG - Intergenic
1102379368 12:112450550-112450572 TTTCTGACACTCAGGGCACAAGG - Intronic
1102807134 12:115791932-115791954 TATCTAACACTCTGGGAACAGGG + Intergenic
1104182187 12:126392898-126392920 TTTCCATCCTTCTGGGGACACGG - Intergenic
1105502470 13:20984411-20984433 TTTCAGTAACTCAGGGAAAATGG + Intronic
1105826887 13:24130630-24130652 TTCACTTCACTTAGGGAACATGG - Intronic
1108440773 13:50450792-50450814 CTTCCATCCATCAGGGGACATGG - Intronic
1108486027 13:50925989-50926011 TTACCATCTCTCAGGGACTACGG + Intronic
1112788497 13:102978162-102978184 TTTCCATTACTCAGAGGAAACGG + Intergenic
1112895842 13:104298882-104298904 CTTCCAACACCCAGGAAACATGG + Intergenic
1113667253 13:112149433-112149455 GTTCCATCACACAGGGGTCAGGG - Intergenic
1113763720 13:112867762-112867784 ATGCCAGCACTCAGGGAACTTGG + Intronic
1117449424 14:55836600-55836622 TTTCCCTCACTAAGAAAACATGG - Intergenic
1119720667 14:76888136-76888158 TGTCCTTCACTCAGGGAACAGGG + Intergenic
1120913880 14:89692687-89692709 TTTCCTCAATTCAGGGAACAGGG - Intergenic
1121256859 14:92537374-92537396 TGTCCATCAATAAGGGACCAGGG - Intronic
1121404373 14:93710254-93710276 TTTCCATCACCCCAGGAAGATGG - Intergenic
1121666274 14:95674782-95674804 TGTCAATCAATCAGTGAACAGGG + Intergenic
1126166014 15:45654524-45654546 TTTCCCTCACTCAGCCAAGAAGG - Intronic
1126170710 15:45693164-45693186 TTGCCAGGACTCAGAGAACAAGG - Intergenic
1129493691 15:75955371-75955393 TTGCCATCTCTCAGGGCTCATGG + Intronic
1129553122 15:76474917-76474939 TTTTCATTACTCAGGGAAATTGG - Intronic
1131347328 15:91662717-91662739 TTACCCTCACTCAGGAGACAAGG - Intergenic
1131755020 15:95550362-95550384 TCTCAAACACTCAGGGAAGACGG - Intergenic
1132988020 16:2777927-2777949 TGTCCAGCATTCAGGAAACAGGG - Intergenic
1133451899 16:5910852-5910874 CTTCCATCTGTCACGGAACAGGG - Intergenic
1133515886 16:6508269-6508291 ATTCCATCACCCAGGTAATAAGG - Intronic
1133587254 16:7207998-7208020 TTTCCATCACTCACTGAAACCGG + Intronic
1133770752 16:8866287-8866309 TGTCCCTGACCCAGGGAACACGG + Intronic
1134243631 16:12523762-12523784 TTTCCACCACTCAGTGATCAGGG - Intronic
1138928202 16:61617806-61617828 TCTCCATCACAAAGTGAACATGG + Intergenic
1139276448 16:65732165-65732187 ATTTAATCACTCAGGGCACAGGG + Intergenic
1140716551 16:77731328-77731350 TTTCCATCAATGATGGACCATGG + Intronic
1143270140 17:5669298-5669320 TTCCCTTCACTCAGGGCTCAGGG - Intergenic
1143780341 17:9225810-9225832 TTTCCTTCACCCAGGGCACTTGG + Intronic
1143973868 17:10815617-10815639 TTGCCATCCCTCAGGGGAGAGGG - Intergenic
1150826439 17:68480319-68480341 TTCCCATAACTCAGGCCACAGGG - Intergenic
1151144156 17:72024144-72024166 TTTTCATCACTCAGGTAAAATGG - Intergenic
1151813620 17:76459932-76459954 TTTCAGTCACCCTGGGAACAAGG - Intronic
1153989925 18:10387333-10387355 ATTCCAACACTCACTGAACAAGG + Intergenic
1154390427 18:13931930-13931952 TTTCCCTCACTCTGGGGCCAGGG + Intergenic
1154957378 18:21272189-21272211 TTGCCGTCACTCAGGGATCCAGG + Intronic
1157735519 18:50045248-50045270 TTTCTATCACTGTGGGAACATGG + Intronic
1157959774 18:52140247-52140269 TTTCCACCACTCCATGAACAGGG - Intergenic
1158446085 18:57522701-57522723 ATGCCATCACTCAGGGACCTAGG - Intergenic
1158939031 18:62389829-62389851 TTTCTATCACACAGGGAAGAGGG - Exonic
1159005164 18:63004619-63004641 TTTCCCTCACTCAGGTAACTTGG - Intergenic
926079250 2:9970705-9970727 TTTTCTTCCCCCAGGGAACAAGG - Intronic
926233264 2:11020747-11020769 TCTCCATCACAAAGGGAACATGG + Intergenic
927602201 2:24453685-24453707 TTTCTATAAATCAGGCAACAAGG + Intergenic
928372788 2:30753213-30753235 TATACATCACTCAGTGACCAGGG + Intronic
928716251 2:34064089-34064111 TTTTTATGACTCAGGGAACAGGG + Intergenic
931858713 2:66331405-66331427 TTGCAATCACTCAGGGACCCAGG + Intergenic
932039579 2:68285065-68285087 TGTTCCTCCCTCAGGGAACAAGG - Intronic
933373700 2:81450883-81450905 TTTCCATCAGTCATTGCACATGG - Intergenic
934558897 2:95302102-95302124 TTTCCATCACTCGGGACAGATGG - Intronic
934924002 2:98368724-98368746 TTCCCAAAACTCAGGGATCAGGG + Intronic
936691238 2:114891783-114891805 CTTCAATCACTCAAGGAAAAAGG - Intronic
936944955 2:117921790-117921812 TGTCCTTCACTCAGGGAGCAAGG + Intronic
937662303 2:124444911-124444933 TTTCCAGCACTCAGTGCACAGGG - Intronic
939575470 2:143889883-143889905 ATTCCATCACACAGCGACCAGGG + Intergenic
941086328 2:161122323-161122345 TTGCCATCATTCAAAGAACATGG + Intergenic
941192420 2:162402131-162402153 CTTCCATCAAGCAGGGAACCTGG - Intronic
942351853 2:175061074-175061096 TTTCCCTAGCTCAGGAAACATGG - Intergenic
942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG + Intergenic
943041448 2:182810161-182810183 TTTACATCCCTCAGAGGACATGG - Intergenic
945856079 2:215071648-215071670 TTGCCATCTCACAGGGCACAGGG + Intronic
947670542 2:231932914-231932936 TATCCATCCCTGAGGGAAGAAGG - Intergenic
1168974960 20:1957956-1957978 TTTCTCTCTCTCAGGGATCACGG - Intergenic
1169159848 20:3368332-3368354 TTTCCGTCTCTCAGGGAATCAGG + Intronic
1174494371 20:50930016-50930038 TTTCCAGCAGACAGGGATCAAGG + Intronic
1174754054 20:53140786-53140808 TGTGCATCACTCTGGGAAGAGGG + Intronic
1174871795 20:54189891-54189913 TTACCATGACTCAGGTAAAAGGG + Intergenic
1175747138 20:61465150-61465172 TTTCTGTCCCTCTGGGAACAAGG + Intronic
1175912177 20:62410258-62410280 TCTCCGTCACTCAGGGGACCCGG + Exonic
1180978081 22:19861931-19861953 TGTCCATCAATAAGAGAACAGGG - Intergenic
1182963262 22:34496731-34496753 TTGCCACCACTCAGGGACAATGG + Intergenic
1183036171 22:35142472-35142494 GTCCCTTCTCTCAGGGAACATGG - Intergenic
1184458713 22:44625419-44625441 TTTCCATGACACTGGGAACCTGG - Intergenic
1184863416 22:47189651-47189673 TTTCCCTCTGTAAGGGAACAAGG - Intergenic
1185035636 22:48475226-48475248 TTCCCTTCACTCTGGGAACATGG - Intergenic
950797448 3:15521471-15521493 CTTCCATCTGTCAGGGGACAGGG - Intronic
952898435 3:38094603-38094625 CTACCATGACTCAGGGGACATGG - Intronic
954942582 3:54388193-54388215 TTTCCAGAACTCAGGGAAGATGG + Intronic
961882372 3:130071047-130071069 TTCACATCACTCAGGGATCTTGG + Intergenic
962470330 3:135702122-135702144 TTTTAATCACTCAGGTAATAAGG - Intergenic
964424604 3:156538439-156538461 TTTCCATCATTCTGATAACACGG - Exonic
967209852 3:187158765-187158787 TATGCATCACACAGGGAACAGGG - Intronic
971446107 4:26750679-26750701 TTTAAAGCACTCAGGGAAAATGG - Intronic
971719072 4:30221308-30221330 TTTCAATAACTCAGGTAAGAAGG + Intergenic
974881710 4:67766739-67766761 GTTCCATCATTCTGGGAAAATGG - Intergenic
974907816 4:68078838-68078860 TTTCCATCACTCAGGGAACAGGG + Intronic
977286360 4:95112253-95112275 CTTCCAACACTCTGGGAACGAGG + Intronic
977395283 4:96463415-96463437 TTTCCATCTCTCAGGGTTCTGGG - Intergenic
980283905 4:130757447-130757469 TTTCCATCATGGAAGGAACAAGG + Intergenic
984547102 4:181119541-181119563 TTTCTTTCACTCAGGGCACTGGG - Intergenic
984658675 4:182348961-182348983 TTTACATCACTCTAAGAACAAGG - Intronic
985213423 4:187620664-187620686 TTTCCATTACCCAATGAACAAGG + Intergenic
986034198 5:3922747-3922769 TTTCCATCAGTCAGAGCACCAGG + Intergenic
989269648 5:39517136-39517158 TTTCCATAGCTCAGGGAACTTGG + Intergenic
989493942 5:42089664-42089686 TTTGAATCACTGAGGAAACATGG - Intergenic
991385747 5:66087207-66087229 TCTCCATCCTTCAGGGACCACGG - Intergenic
992864316 5:80942146-80942168 CTTCCTTCACTCAAGGATCATGG - Intergenic
993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG + Intergenic
993592347 5:89809607-89809629 TTTCAGTCAGTCAGTGAACATGG + Intergenic
994107924 5:95966889-95966911 TTTTCTTCAATCAGGGAAGAAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995769982 5:115657986-115658008 ATTCCATGACTCAGGGGACAGGG - Intergenic
995867798 5:116710211-116710233 TTCCCTTCTCTCAGGGATCATGG - Intergenic
996464558 5:123784517-123784539 TTTTCATCACTCAGGGTTCAAGG + Intergenic
997904712 5:137804935-137804957 ATTTCATCACCCAGGTAACAAGG + Intergenic
999871095 5:155752280-155752302 TTTCCATTGCTCTGAGAACATGG + Intergenic
1001120715 5:168977841-168977863 TTTCCATCTCTGAGGGCTCAGGG - Intronic
1003098844 6:3162237-3162259 TTTTCAACAGTCAGGGAACGCGG - Intergenic
1004006337 6:11640660-11640682 TTTCCATTACTCAGTGAAAAAGG + Intergenic
1006055242 6:31379138-31379160 TTTCCAACCCTCAGTGAGCAAGG + Intergenic
1006463228 6:34176245-34176267 TTTCATTCACTCAGCAAACAAGG + Intergenic
1008577425 6:52874336-52874358 TCTCAATGAGTCAGGGAACATGG - Intronic
1011033753 6:82951446-82951468 TTTCCTCCACTCAGGGACCAAGG + Intronic
1011063960 6:83303808-83303830 TCTCCATCACTCTGAGAACATGG - Intronic
1011279235 6:85660439-85660461 TTTCCACCAATCAGGAAACTAGG + Intergenic
1016637057 6:146304757-146304779 TTGCCAGAACTCAGGGAACCAGG - Exonic
1017026484 6:150185816-150185838 TCACCATCACTCAGGGACCTAGG + Intronic
1019678380 7:2329637-2329659 TTTCCTTCCCCCAGGGAATAGGG - Intronic
1019856002 7:3608667-3608689 TCTGCATCACTCAGCGAACCAGG + Intronic
1023749510 7:43358268-43358290 TTCCCATAAGTCAGGGATCAGGG - Intronic
1025258281 7:57399796-57399818 GCTTCACCACTCAGGGAACAGGG - Intergenic
1025610354 7:63071934-63071956 GATTCACCACTCAGGGAACAGGG + Intergenic
1025753227 7:64311499-64311521 GCTTCATCACTCAGGGAACAGGG - Intronic
1026450095 7:70521143-70521165 TTTTCTCCACTCAAGGAACAAGG - Intronic
1032145264 7:129373751-129373773 TTTCCCTCACTCAGGTAAAAAGG - Intronic
1032466410 7:132148413-132148435 TCTGGATCACTAAGGGAACATGG + Intronic
1034025757 7:147701978-147702000 TTTCCTTAACTGAGGGAAAAAGG + Intronic
1035075016 7:156171550-156171572 TTTCCAGGACTCAGGGACGACGG + Intergenic
1037601961 8:20404474-20404496 TTTGCCTCAGTCAAGGAACAGGG - Intergenic
1037645037 8:20785303-20785325 TCTCCATCACTCTTGGGACAAGG - Intergenic
1041320825 8:56610842-56610864 TTTCCAGCACTGAGGGTAAAGGG + Intergenic
1041642157 8:60214741-60214763 TTTCCAACCCACAGGAAACATGG + Intronic
1043697443 8:83237957-83237979 TTTCCATCACTGAGGTAAATGGG - Intergenic
1044247308 8:89963996-89964018 TTCCCATCATTCAGGACACATGG + Intronic
1045002351 8:97889324-97889346 TTTACATCACTATGGAAACAAGG - Intronic
1048534161 8:135276850-135276872 ATTTCATCACTCAGGTAATAAGG + Intergenic
1051036241 9:12749229-12749251 TTGCCATCACTCTGGGAATCAGG + Intergenic
1051171392 9:14321594-14321616 TTTCCACCACTGAGGGGAGAGGG + Intronic
1051837155 9:21352968-21352990 TTTCCATCACCCAGAGATCTAGG + Intergenic
1051846894 9:21462104-21462126 TTTCCATCACTCAGAAACCTAGG - Intergenic
1052969202 9:34366434-34366456 TTTCCATCTCCCAGGGACCCAGG + Intergenic
1053423707 9:37997467-37997489 TTTCGATCACTCAGGTTCCAGGG - Intronic
1053451889 9:38200722-38200744 TTTCCCTCCTCCAGGGAACAGGG + Intergenic
1057279187 9:93698146-93698168 CATCCCTTACTCAGGGAACATGG - Intergenic
1058920402 9:109609067-109609089 TGCCCATCACACAGGGAGCAGGG - Intergenic
1059612389 9:115912772-115912794 TTTTCATCTCTCAGGGAAAAAGG + Intergenic
1061710272 9:132482582-132482604 TTCCCATCACTCATTAAACAGGG - Intronic
1186320923 X:8424334-8424356 TATCCATCCCTCAAGAAACATGG + Intergenic
1188066533 X:25667837-25667859 TTTCCTTCCCTAAGGGATCACGG + Intergenic
1189720448 X:43910695-43910717 ATTCCATCACTCAGTGGCCATGG + Intergenic
1190878154 X:54474463-54474485 TTCCCAGCACTGAGGGAACAGGG + Intronic
1194366442 X:93019441-93019463 TTTCCATCACTAGGGCAGCAAGG - Intergenic
1198282376 X:135154678-135154700 TCTCCAACACCAAGGGAACAGGG + Intergenic
1198284661 X:135177650-135177672 TCTCCAACACCAAGGGAACAGGG + Intergenic
1198288583 X:135217844-135217866 TCTCCAACACCAAGGGAACAGGG - Intergenic
1200674669 Y:6135702-6135724 TTTCCATCACTAGGGCAGCAAGG - Intergenic
1201421010 Y:13798816-13798838 TTTCTCTCAGTAAGGGAACATGG + Intergenic