ID: 974908237

View in Genome Browser
Species Human (GRCh38)
Location 4:68083071-68083093
Sequence TCATGGGTATGCAGCTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974908237_974908245 19 Left 974908237 4:68083071-68083093 CCACATAAGCTGCATACCCATGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 974908245 4:68083113-68083135 GACCCCTCACCCTTGACAGTAGG 0: 1
1: 0
2: 1
3: 1
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974908237 Original CRISPR TCATGGGTATGCAGCTTATG TGG (reversed) Intronic
900677228 1:3895220-3895242 ACTTGGGTAAGGAGCTTATGAGG + Intronic
911126299 1:94343950-94343972 ATAGGGGTCTGCAGCTTATGTGG - Intergenic
912054169 1:105574263-105574285 ACAAGGGGATGCATCTTATGAGG + Intergenic
915894187 1:159798600-159798622 TCCTGGCTATGCAGCTTACTAGG - Intergenic
920264225 1:204709895-204709917 TCATGGCTATGCCACTTCTGGGG + Intergenic
920789313 1:209073511-209073533 TCATGGTTATGTAACTCATGAGG - Intergenic
922377295 1:224981055-224981077 TCATGTGTATTCTGTTTATGTGG + Intronic
924221598 1:241881356-241881378 TCATGGGAATGCAGATTATAAGG + Intronic
924723957 1:246650342-246650364 TCATGTATATGTAGCTTTTGGGG - Intronic
1065075214 10:22071844-22071866 TCATGGGGATGCAACTTCTCTGG + Intergenic
1069330158 10:67282648-67282670 TCAGGGGTATGGAGCTTTTGAGG + Intronic
1070483400 10:76907474-76907496 TCATGGGTGTTCAGCCTATGTGG + Intronic
1070514272 10:77189155-77189177 TAATGGGGATGCTGCTTATCTGG + Intronic
1080962863 11:37180657-37180679 TCCTGGGTATGCATGTTAAGAGG + Intergenic
1081494157 11:43589830-43589852 TCAAGGGCATGCAGCTAATAAGG - Intronic
1081788799 11:45768115-45768137 TCATGGGTCTGCAGGTTAGTTGG + Intergenic
1087501647 11:98962784-98962806 TCATAGGTGTTCAGCTTAAGAGG - Intergenic
1087510616 11:99087878-99087900 TCACGGGCATGCAACCTATGTGG + Intronic
1088024078 11:105156487-105156509 TCCTGGGTATGCATCTCATTTGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091806422 12:3359761-3359783 TCATGGGTGTGCAACATGTGTGG + Intergenic
1092335667 12:7630731-7630753 ACGTGGGTATACAGCTAATGAGG + Intergenic
1097922625 12:65092751-65092773 TTATGAGCATGCAGCTCATGGGG + Intronic
1100056975 12:90524041-90524063 TCCTGGGTATGCTGCTTCTGTGG - Intergenic
1106745171 13:32696472-32696494 GCATGGTCATGAAGCTTATGGGG - Intronic
1111021721 13:82459565-82459587 TTATGGGAATGCATCTTATGGGG + Intergenic
1120794070 14:88612071-88612093 TCATGGTACTGCAGCTTAGGGGG + Exonic
1128668603 15:69557400-69557422 TCATGGGCACGCAACCTATGAGG - Intergenic
1130172464 15:81529976-81529998 TGATGGGTCTGCACTTTATGAGG - Intergenic
1135378252 16:21969789-21969811 TAATGGGTATGGGGCTTTTGGGG - Intronic
1136931931 16:34426364-34426386 TCATGCTTATGCAGGATATGGGG + Intergenic
1136972641 16:34985451-34985473 TCATGCTTATGCAGGATATGGGG - Intergenic
1137223803 16:46482436-46482458 CCATGGGTGTGCAGCTGGTGTGG - Intergenic
1137856040 16:51795632-51795654 TCCTGGGAATGCAGCTCAGGAGG - Intergenic
1156288396 18:35722104-35722126 TTGTGGGTATGCAGCTGGTGGGG - Intergenic
1157173794 18:45432433-45432455 TCATGGGCAAGGAGCTTATTAGG - Intronic
1157273262 18:46292889-46292911 TCATGGGTCTGCAGTTTACTGGG - Intergenic
1160210199 18:76871311-76871333 TCATTGGTATGCAGATGGTGCGG + Intronic
925241653 2:2336246-2336268 TCAAGGGTGTGCAGGTAATGTGG - Intergenic
926494389 2:13566816-13566838 TCCTGGGTATGCATCTTCTCTGG - Intergenic
927651885 2:24918316-24918338 TCAAGGGGATGCAGCTGCTGCGG - Exonic
930780011 2:55215527-55215549 TGATGGGTATGCAGTTTATCTGG - Intronic
932893335 2:75614659-75614681 TCATGTGTATGTAACTTAAGAGG - Intergenic
933165543 2:79070746-79070768 TAATGGGTATACAGCTATTGGGG - Intergenic
935806239 2:106750607-106750629 TCATGGTGATGCTGCTTGTGAGG - Intergenic
936508302 2:113125757-113125779 TCAAGGTGATGCAGCTTGTGAGG - Intronic
940742609 2:157526699-157526721 TTATGTGTATGCAGTGTATGCGG - Intergenic
941858629 2:170255035-170255057 CCATGGGTGTGCAGCTGGTGTGG - Intronic
944302197 2:198136613-198136635 TCTTGGGCAGCCAGCTTATGTGG + Intronic
946580557 2:221123898-221123920 TCATGGGTAAACAGATTATTTGG + Intergenic
948102617 2:235387119-235387141 TAATGGGTATGTGGCTTATTTGG - Intergenic
948142620 2:235685044-235685066 TCAGGGGTGTGCAGGTTCTGAGG + Intronic
1174600164 20:51718009-51718031 TCATTGGTATGCATGTTAGGAGG - Intronic
1175303795 20:57961820-57961842 TCCAGGGTAAGCGGCTTATGGGG + Intergenic
1178477243 21:32947687-32947709 TAATGGGTATGCAGTTTTTGCGG - Intergenic
1178594254 21:33938582-33938604 TAATGGGTATGAAGCTTCTTTGG - Intergenic
1181461173 22:23086751-23086773 TCATGGGGCTGCAGCATCTGTGG + Intronic
1184307314 22:43614326-43614348 TCAAGGGTATGTTGATTATGTGG - Intronic
1184768744 22:46586164-46586186 TCTTGGGAATGCAGCTTAGGGGG + Intronic
950980496 3:17299199-17299221 AAATGGGCAGGCAGCTTATGTGG + Intronic
951420337 3:22476223-22476245 TCATGATTATGAAGCTGATGGGG + Intergenic
955020858 3:55119784-55119806 CCAAGGGCATTCAGCTTATGAGG + Intergenic
956889677 3:73599806-73599828 TCACTGGGATGCACCTTATGTGG - Intronic
959082979 3:101821871-101821893 TCATCTGGATGCAGCTTGTGCGG - Exonic
960434895 3:117614270-117614292 TGATGGATATGAAGGTTATGTGG - Intergenic
961411792 3:126727483-126727505 TCATGGCTATGCCGCCTCTGAGG - Intronic
961657148 3:128449474-128449496 TCATGGGTGAGAAGCTGATGGGG + Intergenic
963685016 3:148422178-148422200 TCATGCTTATGCAGCTTGTAGGG - Intergenic
965054906 3:163699372-163699394 TTATGGGAATGCATCTAATGAGG - Intergenic
967154142 3:186677356-186677378 TCATGGGAATGATGCTTATGGGG - Exonic
969329630 4:6466395-6466417 TCATGGATATGCAACCTGTGTGG - Intronic
974908237 4:68083071-68083093 TCATGGGTATGCAGCTTATGTGG - Intronic
976974227 4:91147211-91147233 TCATGGGTGTGCAACTGGTGTGG + Intronic
978316933 4:107448558-107448580 TAATGGGTATCTAGCTTATATGG + Intergenic
979651149 4:123133180-123133202 TCTGGGATATGCAGCCTATGGGG + Intronic
980934447 4:139212753-139212775 TCATGGGTGTGCAACCTGTGTGG - Intergenic
983660799 4:170129060-170129082 CCATGGAAAAGCAGCTTATGTGG - Intergenic
990600190 5:57350650-57350672 TCCTGGGAATGCAGCTTAGTAGG + Intergenic
992099845 5:73396460-73396482 TCATGGGTCTGGAACTTAAGGGG + Intergenic
994884600 5:105543429-105543451 TTATGGGAAAGCAGTTTATGTGG + Intergenic
1000107882 5:158078012-158078034 TCATTGGTATCCAGCTAAAGGGG - Intergenic
1000719354 5:164687400-164687422 TCATGTCTATGCAGCTTTTAAGG - Intergenic
1001541147 5:172540581-172540603 TCATGGGTACCCAGTTCATGAGG - Intergenic
1010065580 6:71679226-71679248 TCATAGGGATGCAGCTTCAGAGG - Intergenic
1015696982 6:135991244-135991266 TCCTGGGAATGCAGTTTATCAGG + Intronic
1016114902 6:140268411-140268433 TTGTGTGTATGCAGTTTATGTGG + Intergenic
1018540267 6:164872257-164872279 TCATTTTTATGCAACTTATGAGG - Intergenic
1019844189 7:3480520-3480542 CCATGGGCAGGCAGCTTATCGGG - Intronic
1021845583 7:24759262-24759284 TGATGAGTATGCTGTTTATGAGG - Intergenic
1021896885 7:25244934-25244956 TCCTGGGTATGCACATTATATGG + Intergenic
1022616297 7:31933866-31933888 TCATGGTTCTGCAGGTTGTGTGG - Intronic
1032725632 7:134587966-134587988 TTATGGGAATGCATCTGATGGGG + Intergenic
1038104889 8:24422113-24422135 TTATGGGGATGCACCTTATTAGG + Intergenic
1038524993 8:28265158-28265180 TTATGGATATACAGCCTATGTGG + Intergenic
1039093053 8:33853110-33853132 TCTTGGTAATGAAGCTTATGTGG - Intergenic
1043385482 8:79743751-79743773 GCATGTTTATGCGGCTTATGTGG - Intergenic
1046133993 8:110003427-110003449 TCATGGTTCTGCAGGGTATGTGG + Intergenic
1047539274 8:125748553-125748575 TCATGGTTATGCAGCTAGTAAGG + Intergenic
1047617978 8:126578988-126579010 TCATTGGTTTGAGGCTTATGTGG - Intergenic
1048596252 8:135869324-135869346 ACATGAGTATGAAGGTTATGAGG - Intergenic
1057780956 9:98049784-98049806 TCATGGGAATGCAGCTCAGAAGG + Intergenic
1187590525 X:20712610-20712632 TCATGTGGATGAAGCTTATGCGG + Intergenic
1187665672 X:21606848-21606870 TCGTGGGTATGTATCATATGGGG - Exonic