ID: 974919397

View in Genome Browser
Species Human (GRCh38)
Location 4:68219668-68219690
Sequence ATGATCATGGAGAATTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974919397_974919399 20 Left 974919397 4:68219668-68219690 CCAGACTAATTCTCCATGATCAT No data
Right 974919399 4:68219711-68219733 AATGCCATTATAGTACATTAAGG No data
974919397_974919401 25 Left 974919397 4:68219668-68219690 CCAGACTAATTCTCCATGATCAT No data
Right 974919401 4:68219716-68219738 CATTATAGTACATTAAGGATAGG No data
974919397_974919402 29 Left 974919397 4:68219668-68219690 CCAGACTAATTCTCCATGATCAT No data
Right 974919402 4:68219720-68219742 ATAGTACATTAAGGATAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974919397 Original CRISPR ATGATCATGGAGAATTAGTC TGG (reversed) Intergenic
No off target data available for this crispr