ID: 974919470

View in Genome Browser
Species Human (GRCh38)
Location 4:68220676-68220698
Sequence ATTTTTCGTAATTTCAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974919470_974919472 19 Left 974919470 4:68220676-68220698 CCTGCATTGAAATTACGAAAAAT No data
Right 974919472 4:68220718-68220740 TATTCACCACCATCAGTAGCAGG No data
974919470_974919475 30 Left 974919470 4:68220676-68220698 CCTGCATTGAAATTACGAAAAAT No data
Right 974919475 4:68220729-68220751 ATCAGTAGCAGGCAGTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974919470 Original CRISPR ATTTTTCGTAATTTCAATGC AGG (reversed) Intergenic
No off target data available for this crispr