ID: 974920353

View in Genome Browser
Species Human (GRCh38)
Location 4:68231340-68231362
Sequence GTTGCCAGTTATGATACTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974920352_974920353 -9 Left 974920352 4:68231326-68231348 CCATTCACAATTTTGTTGCCAGT 0: 1
1: 0
2: 0
3: 25
4: 301
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100
974920348_974920353 10 Left 974920348 4:68231307-68231329 CCCCTCCAGGGAGCTTTTTCCAT 0: 1
1: 0
2: 2
3: 15
4: 214
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100
974920349_974920353 9 Left 974920349 4:68231308-68231330 CCCTCCAGGGAGCTTTTTCCATT 0: 1
1: 0
2: 0
3: 26
4: 215
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100
974920346_974920353 16 Left 974920346 4:68231301-68231323 CCATGCCCCCTCCAGGGAGCTTT 0: 1
1: 0
2: 1
3: 51
4: 354
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100
974920351_974920353 5 Left 974920351 4:68231312-68231334 CCAGGGAGCTTTTTCCATTCACA 0: 1
1: 0
2: 0
3: 17
4: 195
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100
974920347_974920353 11 Left 974920347 4:68231306-68231328 CCCCCTCCAGGGAGCTTTTTCCA 0: 1
1: 1
2: 6
3: 41
4: 365
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100
974920344_974920353 22 Left 974920344 4:68231295-68231317 CCATGGCCATGCCCCCTCCAGGG 0: 1
1: 0
2: 2
3: 47
4: 418
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100
974920350_974920353 8 Left 974920350 4:68231309-68231331 CCTCCAGGGAGCTTTTTCCATTC 0: 1
1: 0
2: 1
3: 15
4: 184
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100
974920342_974920353 26 Left 974920342 4:68231291-68231313 CCTGCCATGGCCATGCCCCCTCC 0: 1
1: 1
2: 5
3: 58
4: 759
Right 974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974920353 Original CRISPR GTTGCCAGTTATGATACTGT TGG Exonic
901412715 1:9095705-9095727 GTTTCCAGTTATGCTAATATTGG - Intergenic
908823798 1:68114775-68114797 ACTGCCAGTTATCATACTATGGG + Intronic
908893506 1:68872342-68872364 GGTGGCAGTGCTGATACTGTAGG - Intergenic
916993841 1:170274425-170274447 GTTGCCAGTAATGATGCACTGGG + Intergenic
921847286 1:219897689-219897711 GTTATCAGGTAAGATACTGTAGG - Intronic
1071062589 10:81590408-81590430 TTGGCCAGATATGATACTCTGGG - Intergenic
1071418678 10:85465791-85465813 TTTGCCAGATATGCTACTCTAGG - Intergenic
1073174209 10:101541915-101541937 GTTGACTGTCATGATAATGTTGG + Intronic
1074600606 10:114909553-114909575 GTAGCTAGTCATGCTACTGTGGG - Intergenic
1076104645 10:127811619-127811641 GTAGCCAGTGATGAGACTCTAGG + Intergenic
1076988449 11:256507-256529 ATTGTCAGTGATAATACTGTGGG - Intergenic
1078879334 11:15432751-15432773 GTTTCCTGTTATGATACTAATGG - Intergenic
1079972152 11:27048716-27048738 ATGGCCAGTAATGATACTGCTGG + Intronic
1090403234 11:126462169-126462191 GTTGACAGTTATGATGCTTCAGG - Intronic
1093413078 12:18889889-18889911 GTTGCCAATTATGATCCTTGAGG - Intergenic
1094533922 12:31304402-31304424 GTTGCCAGTTATGACAGTAACGG + Intronic
1098395505 12:70012729-70012751 TTTGCCAGATATGCTATTGTAGG - Intergenic
1100645363 12:96523566-96523588 CTTGCCAATTAATATACTGTTGG - Intronic
1102956607 12:117063106-117063128 GTTGCCACTCATGATTATGTGGG - Intronic
1106560481 13:30841312-30841334 GTTGCCTGCTGTGATGCTGTTGG - Intergenic
1109242939 13:59913402-59913424 TTTGGCAGTAATAATACTGTGGG - Intronic
1109579381 13:64306351-64306373 GATGCTAGTTAAGACACTGTTGG - Intergenic
1115027041 14:28758067-28758089 TTTTCCTGTAATGATACTGTTGG + Intergenic
1115981357 14:39055341-39055363 GTAGCCAACTATGATATTGTGGG - Intronic
1116877033 14:50122304-50122326 CTTGCCAGTTATGATTTTGAGGG + Intronic
1120636183 14:86954109-86954131 GTAGCCATTTTTGATACTGCTGG - Intergenic
1122327822 14:100893028-100893050 GTTGCCATTTGGGAAACTGTTGG + Intergenic
1131521981 15:93123294-93123316 GTTGCATGTTCTGATTCTGTGGG + Intergenic
1132150599 15:99455457-99455479 CTTGCCAGGTATGAAACCGTTGG + Intergenic
1132318881 15:100910427-100910449 GTTGCCAGTACTGTTGCTGTTGG - Intronic
1136363902 16:29799647-29799669 GTTGGCAATAAGGATACTGTGGG - Exonic
1138460629 16:57145760-57145782 CTTGCCAGTTGCTATACTGTGGG - Intronic
1140226693 16:73083390-73083412 GTTACCAGTTGTGATACAGAAGG - Intergenic
1140742740 16:77955887-77955909 GTTGCCAGGTATGAGACAGTGGG - Intronic
1148189456 17:45668421-45668443 GTTGCCAGTTATAGTTCTGGTGG + Intergenic
1148661730 17:49339616-49339638 GTAGCCAGTGAAGATAATGTCGG - Intronic
1153044854 18:846669-846691 GATGCTAGTAATGACACTGTGGG - Intergenic
1153461695 18:5341385-5341407 ATTGTCAGTCATCATACTGTTGG - Intergenic
1157974463 18:52310992-52311014 GATGCCAGTTATTAAAATGTAGG + Intergenic
1158007109 18:52685456-52685478 ATTCCCAGTTATGACAATGTTGG + Intronic
1161120762 19:2525072-2525094 GTGGCCAGTTCTGCTGCTGTTGG - Intronic
1167150177 19:47704032-47704054 GGTTCCAGTTATAATGCTGTTGG - Intergenic
931839298 2:66131743-66131765 GTTGCCAGTGATCATACTTGAGG + Intergenic
932257539 2:70300716-70300738 GTTAACAGTTGTGATACTGATGG - Intronic
934970753 2:98762190-98762212 GTTGCCTGTGATGATGCTCTTGG + Intergenic
935642340 2:105302943-105302965 GTTTCCAATAATTATACTGTGGG + Intronic
945211440 2:207387190-207387212 GTTGGCTGTGATGACACTGTCGG - Intergenic
948227177 2:236320362-236320384 TTAGCCACTAATGATACTGTGGG - Intergenic
1169996117 20:11558514-11558536 GATGCCAGCTCCGATACTGTGGG + Intergenic
1171222595 20:23413176-23413198 GTTGCCACTTAATATATTGTTGG - Intronic
1174352595 20:49979296-49979318 GGTGACACTTTTGATACTGTGGG - Intergenic
1177217040 21:18143993-18144015 GTTGCAAGTTCTGAAAATGTTGG - Intronic
1177505935 21:22016991-22017013 GTTGCCAGGCAAGATAATGTTGG - Intergenic
1178898729 21:36582495-36582517 ATTGCCAGTTTTCATACTGAAGG - Intergenic
1179023495 21:37659856-37659878 GTTGCCAGAGATGATAGTGATGG - Intronic
1183855218 22:40628248-40628270 GTTACCAGGTATGTGACTGTAGG - Intronic
949622905 3:5836085-5836107 TTTGCCAGGTATGATATTCTAGG + Intergenic
952762620 3:36928074-36928096 GTTTCCAGTTGTAATACTGTGGG - Intronic
953579622 3:44141958-44141980 ACTGCAAGTTATGATCCTGTGGG - Intergenic
953888637 3:46734378-46734400 GTTGCCAGTTTTGAGGCAGTGGG - Intronic
956491489 3:69776971-69776993 GTTGAGAGTAATGTTACTGTTGG + Intronic
958701053 3:97590459-97590481 GTTGACAGTTTGGATAATGTTGG + Intronic
960298446 3:115972708-115972730 GCTACAAGTTATGATACTGTTGG + Intronic
962339029 3:134565875-134565897 ATTACCAGTTATGAAAATGTTGG - Intronic
964119737 3:153170506-153170528 GTCATCAGTTATAATACTGTGGG + Intergenic
967137862 3:186527792-186527814 GTTGCCAGTACTGATACATTAGG - Intergenic
967897343 3:194408688-194408710 GTTTCCAATTATGGTACAGTAGG - Intronic
968108263 3:196019478-196019500 GTTGGAAGTTCCGATACTGTAGG - Intergenic
971418647 4:26455939-26455961 GGTGCCAGCAAGGATACTGTTGG + Intergenic
971501298 4:27320844-27320866 GTTTCTAGTTCTGATAGTGTAGG - Intergenic
974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG + Exonic
977378066 4:96234666-96234688 GATGCCAGATTTGTTACTGTTGG + Intergenic
978342157 4:107730079-107730101 GTTGCCAGTCAAGATAATGATGG - Intergenic
978833482 4:113117468-113117490 GTTGCCAGTTCTGAGGCTGATGG - Intronic
979722140 4:123913330-123913352 TTTGCCAGTAATCATACTGATGG + Intergenic
980026374 4:127772408-127772430 GTTGCCATTTCTGATAATCTTGG + Intronic
985721983 5:1494266-1494288 GTAGCCTGTTATGATAGTGAGGG + Intronic
990186970 5:53219980-53220002 GGTGCCATTAATGGTACTGTAGG + Intergenic
992583551 5:78207842-78207864 CTTGCTGGTTATGGTACTGTTGG - Intronic
995557157 5:113341479-113341501 GTAGAAAGTCATGATACTGTCGG - Intronic
997055622 5:130439851-130439873 TTTGCCAGGTATAATACTCTAGG + Intergenic
997421368 5:133769539-133769561 TTTGCCACTGATGATACTGATGG - Intergenic
1000349205 5:160340003-160340025 GTTGCCAGTTATTAAAATGAGGG + Intronic
1010766791 6:79784241-79784263 GCTGCCATCTCTGATACTGTCGG - Intergenic
1013918755 6:115374138-115374160 GTTGCCAGTACTGAGACTTTAGG - Intergenic
1016219884 6:141655127-141655149 GTTGCCAGGCAAGATAATGTTGG + Intergenic
1018877775 6:167840733-167840755 GTTGCCAGTTATGAAACCAAAGG + Intronic
1029063148 7:97819833-97819855 GTTCCCAGTTATTTTACAGTAGG + Intergenic
1034833492 7:154330432-154330454 GTGGCCAGTTATGTCACTGTGGG + Intronic
1038137715 8:24806533-24806555 GTGGTCAGTTCTGATACTTTGGG + Intergenic
1039178090 8:34832378-34832400 GATGCCAGTTCTGTTCCTGTAGG + Intergenic
1041554334 8:59135737-59135759 GCTGCCATTTAAGATCCTGTGGG + Intergenic
1042213182 8:66402231-66402253 GTTACCAGTTATGTCAGTGTGGG + Intergenic
1046025981 8:108724487-108724509 GATGCCAGTGATGATAATGGTGG + Intronic
1046139576 8:110072687-110072709 GTAGCCAGTAATGGTATTGTTGG + Intergenic
1048058875 8:130896790-130896812 GTTTACAGTTATCTTACTGTAGG - Intronic
1048209639 8:132444041-132444063 CTTGCCAGTTGTGTCACTGTGGG - Intronic
1048888393 8:138926764-138926786 GTTGCCAGCTAAGATGATGTAGG - Intergenic
1049080741 8:140441376-140441398 GTTGACAGTTATGTTACTGGTGG - Intronic
1055363715 9:75522499-75522521 GTTTCCAGTTATGAGGATGTAGG - Intergenic
1188554396 X:31395717-31395739 GATGCCAGTCCTGATACTGTTGG + Intronic
1189519287 X:41748981-41749003 GTTACCATTTAAAATACTGTAGG + Intronic
1190729127 X:53213257-53213279 GTCGACAGTCTTGATACTGTTGG + Intronic
1193854675 X:86585165-86585187 GTTTACAGTAATGATACTGCTGG + Intronic
1195283835 X:103363202-103363224 ATTGCCAAATATGATTCTGTTGG + Intergenic
1195528548 X:105923280-105923302 GATGCCAGTGCTGATACTGATGG + Exonic
1197009449 X:121543628-121543650 GATGCTGGTCATGATACTGTTGG - Intergenic