ID: 974950497

View in Genome Browser
Species Human (GRCh38)
Location 4:68579322-68579344
Sequence CTCTTTAAGGGTGATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 2, 1: 1, 2: 9, 3: 25, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974950497 Original CRISPR CTCTTTAAGGGTGATGTGGA TGG (reversed) Intronic
900103365 1:972094-972116 CTCCTCCAGGTTGATGTGGACGG - Exonic
900463633 1:2813249-2813271 CTCTTGCAGGGAGGTGTGGAGGG + Intergenic
900997158 1:6128837-6128859 CTCTTCAAGGACGACGTGGAGGG - Exonic
902168529 1:14592254-14592276 CTCTTGGAGGGGGATGAGGAGGG + Intergenic
906371589 1:45258517-45258539 CTCTTCTAGGGTGATGCAGAGGG + Intronic
906667110 1:47629597-47629619 CCCTTTAGGGGAGATGTGGAGGG + Intergenic
906938474 1:50235195-50235217 CTCTGCTAGGGTAATGTGGAAGG + Intergenic
908075781 1:60516437-60516459 TTCTTTGAGGGTGGGGTGGAGGG + Intergenic
910354881 1:86342467-86342489 CTCTTTAAAGGTAATGCGGAGGG - Intergenic
910490110 1:87759754-87759776 CTCTTTCAGGGTGTAGTGGTAGG - Intergenic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
912907068 1:113718524-113718546 CTCTGTGAGGGTAGTGTGGAAGG - Intronic
914726790 1:150334620-150334642 CTCTATAAGAGTTATTTGGATGG - Intronic
915624849 1:157108099-157108121 CTCTTTGGGGGTGAGGTGGGAGG + Intergenic
915894030 1:159797334-159797356 ATCTTAAAGGGTCATGTGAATGG + Intergenic
915932443 1:160068867-160068889 TTGTTTAAGGGTGCTGAGGAGGG - Intronic
915954635 1:160211579-160211601 ATCTTCAAGGGTGATGTTGTTGG - Exonic
919214567 1:194535331-194535353 CCCATTAAGGGTGAGGAGGACGG + Intergenic
921593234 1:217027405-217027427 CTCTGTAAGGGTGGTTTGTAAGG - Intronic
922685867 1:227638510-227638532 CTCTTTAAGGGTAATGCAGACGG + Intronic
922816702 1:228454244-228454266 TCCTTTAGGGGTGATGAGGATGG - Intergenic
924795445 1:247289203-247289225 CTCTTTAAGGGTAATGCGGACGG - Intergenic
924814086 1:247427384-247427406 CTCATTAAGAGTGAGGTGGAAGG + Intronic
1066288135 10:33988449-33988471 CCCTTTAAGAGTGAAGTGAATGG - Intergenic
1069769888 10:70891484-70891506 CAGTTGAAGGGTGATGAGGATGG + Intergenic
1070419821 10:76225474-76225496 CACTTTTTGGGTGATGGGGATGG + Intronic
1072704141 10:97667986-97668008 CCCTTTGAAGGTGAAGTGGAAGG - Intronic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1073822329 10:107278701-107278723 CTCTTTAAGGCTCATGTGTAAGG - Intergenic
1074455787 10:113594235-113594257 CTCTGTGAGGAAGATGTGGAGGG - Intronic
1074515770 10:114167717-114167739 CTTTGGAAGGCTGATGTGGAAGG + Intronic
1075897795 10:126012981-126013003 CTTTTTGAAGATGATGTGGAAGG + Exonic
1077901737 11:6495590-6495612 CACTTTAGGGGTGAGGTGGGAGG + Intronic
1078927399 11:15886953-15886975 GTGTTTGGGGGTGATGTGGATGG - Intergenic
1079007200 11:16800387-16800409 TTTTTTAAGGGTGAAGTGGCAGG + Intronic
1080813931 11:35735417-35735439 GTCTTTCAGGGCGATGAGGAAGG + Exonic
1081452348 11:43183716-43183738 CTCTCTAAAGATGATGGGGAAGG - Intergenic
1082634984 11:55584218-55584240 ATCTTTAAGGGTAATGTGAATGG - Intergenic
1082734257 11:56838798-56838820 CTCTGTTAGGGCAATGTGGAAGG - Intergenic
1085928943 11:81057507-81057529 CTCTTTAAGTGATATGGGGATGG + Intergenic
1085941815 11:81214013-81214035 CTCTGCAAGGGTGATGCGAAAGG - Intergenic
1086005999 11:82036613-82036635 CTCCTTTAGTGTGAGGTGGATGG + Intergenic
1086011846 11:82114279-82114301 CTCTTAAAGGGAGATGAGGTAGG - Intergenic
1086176786 11:83900730-83900752 CTCTGTTAGGGTAGTGTGGAAGG + Intronic
1088431917 11:109768289-109768311 CGCTTTAAGAGGGATGTGGAGGG - Intergenic
1088644728 11:111908797-111908819 CTCTTCACGGGTGATGGGAATGG + Exonic
1090095388 11:123737880-123737902 CTTTTTGATGGTGATGAGGAGGG + Intronic
1093462446 12:19419105-19419127 ATCTTTAAGGGTGATATTGTTGG + Intronic
1095508501 12:42924171-42924193 CTCATTAAGGGTATTGTGCATGG + Intergenic
1096083768 12:48851589-48851611 CTTGTAAAAGGTGATGTGGAAGG + Intronic
1096374266 12:51095163-51095185 CTCTTGAAGGGGGATATGAATGG - Exonic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1100452857 12:94724127-94724149 CTCTTTAAGGCAGAGGTGGGAGG + Intergenic
1101020207 12:100546165-100546187 GTCTTTAAGGGTGATCTGAGTGG + Intronic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102248406 12:111369217-111369239 CCCTTTAAGAGTGATTTCGAGGG - Intergenic
1103174524 12:118850990-118851012 CTCTGCAAGGCTGAGGTGGAAGG - Intergenic
1103953754 12:124565906-124565928 CTCTTTGGGGGTGCTGAGGAGGG - Intronic
1106924705 13:34601614-34601636 CTCTTTAAAGGTAAAGTGGAGGG + Intergenic
1110253865 13:73410077-73410099 CTCTTGGAGGGTAAGGTGGACGG + Intergenic
1111879949 13:93943796-93943818 CTTTTTAAGGGTGATTTAGAGGG + Intronic
1112432187 13:99359791-99359813 CTCTTTAGGGGTGCTGTGCTTGG - Intronic
1114237165 14:20833596-20833618 CTCCTTAAGGGTAACGTGGACGG + Intergenic
1114627535 14:24139183-24139205 CTATTTCAGAGTGATGTGGAGGG - Exonic
1117561274 14:56941924-56941946 GTCTTTCAGGGTGAGGGGGAAGG - Intergenic
1117576075 14:57099485-57099507 CTCTTTAAGGATAATTTAGAAGG + Intergenic
1117739945 14:58806828-58806850 CTCTTTCTGGGTCATGGGGATGG + Intergenic
1118134694 14:63010455-63010477 GTCTTAAAGGGAGATGTGCATGG + Intronic
1118942013 14:70347076-70347098 CTCTTTAAGGGTAATGCGGACGG - Intronic
1124968747 15:34463104-34463126 CTCTCTGAGGGTGAGGAGGATGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1130729066 15:86471779-86471801 CATTTTAAGGGTGATGTAGTAGG + Intronic
1130904599 15:88231322-88231344 CTCTGGATGGGTGATGTGGGTGG - Intronic
1132644518 16:992657-992679 GTCTTTGGAGGTGATGTGGAGGG - Intergenic
1133656671 16:7871672-7871694 CTTTTTGAGGTTGATGTCGATGG + Intergenic
1134374266 16:13656248-13656270 CTCAGTAAGGGTTATTTGGATGG - Intergenic
1134503753 16:14789332-14789354 CTGTTTATGGGAGATGTTGAAGG + Intronic
1134725623 16:16416922-16416944 CTGTTTATGGGAGATGTTGAAGG + Intergenic
1134941811 16:18294936-18294958 CTGTTTATGGGAGATGTTGAAGG - Intergenic
1135280717 16:21151989-21152011 CTCTGAAAGGCTGAGGTGGATGG + Intronic
1140311553 16:73853956-73853978 CTCTTTTAGGGTGATCCTGATGG - Intergenic
1147038922 17:37702194-37702216 CTGTTTTAGGTGGATGTGGAAGG + Intronic
1148588023 17:48794679-48794701 CTGCTTAAAGGGGATGTGGAAGG - Intronic
1150352823 17:64458902-64458924 CTGTTTATGGGGGGTGTGGATGG + Intronic
1151059218 17:71071559-71071581 CTCTCTATGGGTGAAGAGGATGG + Intergenic
1152142468 17:78544892-78544914 CACTTTAATGGAGATGTGTAGGG - Intronic
1152814923 17:82402065-82402087 TTCTTTAAGGGTGATTTTTATGG - Intronic
1153225378 18:2895808-2895830 CTCTTGAAGGGTGACGTGGCTGG + Intronic
1153979095 18:10294247-10294269 CGCTCTAAGAGGGATGTGGAGGG + Intergenic
1153992445 18:10412429-10412451 CTCTAAAAGGATGATGTGGGTGG + Intergenic
1154100615 18:11469511-11469533 CTTTTTATGTGTGATGTGTATGG + Intergenic
1156159447 18:34342213-34342235 AGGTTTAAGGGTGATCTGGATGG - Intergenic
1156376895 18:36522868-36522890 ATGTTCAAGTGTGATGTGGAGGG + Intronic
1157590540 18:48833873-48833895 TGCTTTGAGGGTGATCTGGAAGG - Intronic
1159272460 18:66169931-66169953 CTCTTTATTGGTGATGTGAGGGG + Intergenic
1160072454 18:75640542-75640564 CTCTGTAAGGTTTAAGTGGAAGG - Intergenic
1161527200 19:4763761-4763783 CACTTTACGGGTGATGATGATGG - Intergenic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
1164582278 19:29442056-29442078 CCCTTTAAGGCTGATGGGGAGGG - Intergenic
1164757803 19:30703267-30703289 GGCTTTAAGGGAGATGAGGAGGG + Intronic
1165388687 19:35526474-35526496 CTTTGTAAGGGAGATGGGGAAGG + Intronic
1165396343 19:35565806-35565828 CTCTGGAAGGCTGAGGTGGACGG + Intergenic
1166590771 19:43996464-43996486 CTCTTTATGTGTGATGTGTGTGG + Exonic
1166597868 19:44066435-44066457 CTCTTTAAGTGTGACGTGTGTGG + Exonic
1167618068 19:50547107-50547129 CTGCTCAAGGGAGATGTGGATGG + Intronic
1167820716 19:51925305-51925327 CTCTTTATGGGTGTTGTGTTGGG - Intronic
925673190 2:6333626-6333648 CTCTATAAAGGTGTTGGGGAAGG - Intergenic
929785078 2:44983789-44983811 CTTTGGAAGGGTGATGTGGGAGG + Intergenic
932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
933439014 2:82286071-82286093 TTTTGTAGGGGTGATGTGGAGGG - Intergenic
933855787 2:86412791-86412813 CTTTTGGAGGCTGATGTGGAAGG - Intergenic
935134319 2:100286199-100286221 CTGGTTTAGGGTGATGTGAAAGG - Intronic
936269474 2:111037811-111037833 CTCTTAAAGAGTGCGGTGGATGG - Intronic
938832246 2:135063077-135063099 CTCTTTAAATGTGAAGTGGGGGG + Intronic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
944059042 2:195552869-195552891 ATGTTTAAGGGTGGTGAGGAAGG - Intergenic
946378809 2:219330918-219330940 CTCTTCAACTGGGATGTGGAAGG - Intronic
946536295 2:220633125-220633147 CTCATTAAGGGTTATGAGGTGGG + Intergenic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
948892779 2:240915424-240915446 CTCTGTGAGGGTGCAGTGGATGG - Intergenic
1169992835 20:11522731-11522753 CTCTCTAAGAGTGAACTGGAGGG + Intergenic
1170759700 20:19238900-19238922 CTTTTTTTGGGTGAAGTGGAGGG - Intronic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1171983064 20:31640477-31640499 GCCTTTAAGGGTGAAGAGGAGGG + Intronic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174737381 20:52977659-52977681 GTCTTTAAGGGTGAGGTGAGAGG - Intronic
1174765235 20:53247407-53247429 CTCTTGGAGGGCCATGTGGAGGG - Intronic
1177270597 21:18844376-18844398 GTCTTTAAAAGTGAGGTGGAAGG + Intergenic
1177775420 21:25561579-25561601 CTCTTGAAGGGTGATGAGGTAGG + Intergenic
1178918159 21:36720944-36720966 GGCTTTAAGGGTGATGAGAATGG + Intronic
1179423074 21:41251465-41251487 ATGTATAAGGGTGATGTGGTAGG - Intronic
1180717616 22:17882423-17882445 TTCTTGAAGGGAGATGCGGAGGG + Intronic
1184276917 22:43413932-43413954 CCCTGTACTGGTGATGTGGATGG + Intronic
1184627673 22:45749876-45749898 TTCTTTAAGGTTCATGTTGAGGG + Intronic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
950125863 3:10509452-10509474 CTCTTTGAGGGTGATCTGTGGGG - Intronic
950255080 3:11498023-11498045 CATTTTAAGAGTGATGTTGAGGG + Intronic
953470874 3:43164747-43164769 CTCTTCATGGGGGATGTGGTGGG + Intergenic
956536242 3:70280222-70280244 CTTTTTAAGGGAGAGGAGGAGGG - Intergenic
957508465 3:81155991-81156013 CTCTTTAAGGCAGAGTTGGATGG - Intergenic
959123843 3:102266139-102266161 CTCATTAAGAGTGATTTGAAAGG + Intronic
959759778 3:109946870-109946892 CTCTTTAAGGGAGATAGTGAAGG + Intergenic
960718601 3:120603212-120603234 CTCTGTAAGGCTGGTGTAGATGG + Intergenic
961173433 3:124815409-124815431 CTCTTTAAGGCTTCTGCGGAGGG - Intronic
963095852 3:141539156-141539178 CTATTCAAGGGTGATCTTGAAGG - Intronic
965066648 3:163858171-163858193 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
965335234 3:167425589-167425611 CTTTTAAAGTGTGCTGTGGATGG - Intergenic
968747406 4:2367428-2367450 CTCTGAAAGGGTGGTGGGGATGG + Intronic
970793914 4:19890265-19890287 CTCCTTAAGGGTAATGCGGACGG - Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
972113408 4:35595022-35595044 CTTTTTAGGGATGATGTAGATGG + Intergenic
972887486 4:43510210-43510232 CTCTGCTAGGGTGATGTGAAAGG - Intergenic
973052198 4:45610097-45610119 CTCTTTAAGGATAATGTGGACGG - Intergenic
974950497 4:68579322-68579344 CTCTTTAAGGGTGATGTGGATGG - Intronic
974958884 4:68674841-68674863 CTCTTTAAGGGTGATGTGGATGG - Intergenic
975629046 4:76381107-76381129 CTCTACTAGGGTAATGTGGAGGG + Intronic
975665662 4:76732544-76732566 TTCTTTCAGGGTGATTGGGAAGG - Intronic
975837570 4:78440810-78440832 CTTTTGAATGTTGATGTGGAAGG + Intronic
975858923 4:78655406-78655428 CTCTGGAAGGCTGAGGTGGATGG + Intergenic
976070120 4:81231515-81231537 CTCTGCTAGGGTGCTGTGGAAGG + Intergenic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
977046042 4:92070426-92070448 CACTACCAGGGTGATGTGGAGGG + Intergenic
978233243 4:106425875-106425897 CTATTTAAAGGTGATGTGCTGGG - Intergenic
979040324 4:115783110-115783132 GTCTTTAAGGGTGATCTTGTGGG + Intergenic
979906514 4:126300476-126300498 CTCTTCTAGGGCAATGTGGAAGG - Intergenic
980084960 4:128381308-128381330 CTATTTATGGATGTTGTGGAGGG + Intergenic
980586018 4:134817065-134817087 CTCTTCTAGGGCAATGTGGAAGG - Intergenic
981131394 4:141161950-141161972 CTCTACTAGGGTAATGTGGAGGG + Intronic
983641739 4:169949738-169949760 TTCTTCAAGGGTGATTTGGAAGG - Intergenic
986520162 5:8606837-8606859 CTTTTTAGGGGTGATGTGGAAGG + Intergenic
987047994 5:14125372-14125394 GGCTTCAAGGCTGATGTGGATGG + Intergenic
989351072 5:40487351-40487373 CAATTGAAGGGTGATGTAGAGGG + Intergenic
990185153 5:53203441-53203463 CTCTTTAAGGGTAATGCGGACGG - Intergenic
991331544 5:65497759-65497781 CTTTTTGAGGGTGAGGTGGGAGG + Intergenic
993215858 5:85021789-85021811 CTCTTGTAGGGCAATGTGGAAGG - Intergenic
993400674 5:87446388-87446410 TTCTTGAAGGGAGATGTGAATGG + Intergenic
996078928 5:119232728-119232750 CTCTTAGAGGCTGAAGTGGAAGG + Intronic
997709837 5:135994994-135995016 TTCTTCAAGGGAGATGTAGAAGG + Intergenic
999090838 5:148934518-148934540 GACTTTAAGGGTGATGAGGTGGG - Intronic
1000086577 5:157892759-157892781 CTCTGCAAAGGTGGTGTGGACGG - Intergenic
1000527194 5:162372106-162372128 CTCTAAAAGGGTGTTGTGGGAGG - Intergenic
1000742742 5:164990234-164990256 CTTTTTAAGGGGGATAGGGATGG - Intergenic
1002972392 6:2037180-2037202 CTCATTGAGGGTGAAGTTGAAGG - Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1005509813 6:26502037-26502059 CTCTTTTAGGTTGATGTCGCCGG + Intronic
1005816393 6:29556138-29556160 CACTTTCAGGGTAAGGTGGATGG + Exonic
1006741865 6:36314632-36314654 CCCTGTGAGGGTGCTGTGGAGGG - Intergenic
1007598588 6:43067179-43067201 CTCACTAAGGGTGCTGAGGAAGG + Intronic
1007690087 6:43695301-43695323 CTCTTCCTGGGTGAGGTGGAAGG - Intergenic
1008951335 6:57163122-57163144 CTCTTTTGGGGTGATGAGGAGGG - Intronic
1011175613 6:84556730-84556752 CTCTATAAGGGTGATGAGTGAGG - Intergenic
1011964009 6:93129871-93129893 CTTTTTAATGGTGATGGTGATGG + Intergenic
1012033224 6:94099586-94099608 CTCTTTTAGGGGAATTTGGAGGG - Intergenic
1012446034 6:99307832-99307854 ATCTTAAAGGTTTATGTGGAGGG - Intronic
1016292429 6:142539576-142539598 CTCTTTAAGGATAATGCAGATGG - Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017519633 6:155190435-155190457 CCCTTTAGGGGTGAGGTAGATGG + Intronic
1018556544 6:165056966-165056988 CTTTTGAAGGGTAATGTGTAGGG - Intergenic
1022003368 7:26246050-26246072 CTCTTTAAGGGTAATGCGGATGG - Intergenic
1022211772 7:28217866-28217888 CTCCTTAGGGGTGGAGTGGAGGG - Intergenic
1024532762 7:50407026-50407048 ATCTCTAAGGGGGATGTGGATGG - Intergenic
1025935187 7:66030129-66030151 TTCTTTTGGGGGGATGTGGAAGG + Intergenic
1028581718 7:92416021-92416043 CTCTAGAAGGGCTATGTGGATGG - Intergenic
1029803894 7:102976650-102976672 CTCTTTAAGGGTAATGTGGACGG - Intronic
1030525782 7:110653126-110653148 TTCTTTAAGGGTGGGGTGTAAGG + Intergenic
1033002945 7:137526908-137526930 CTCTTTATGGATAAAGTGGATGG + Intronic
1033889633 7:145995268-145995290 CTCTTGGAGGCTGAGGTGGAAGG - Intergenic
1039411575 8:37359588-37359610 CTCTGGAAGGGTGTGGTGGATGG - Intergenic
1041430690 8:57777866-57777888 CTCTGTTAGGGTGGTATGGAAGG + Intergenic
1042158145 8:65866265-65866287 CTCTTTAAGGGTAATGCGGACGG - Intergenic
1042654217 8:71077872-71077894 CTCTTTAATGGTGATGATGATGG - Intergenic
1042832169 8:73042545-73042567 CTCTTTAATTCTGATGAGGAAGG - Intronic
1043745204 8:83866717-83866739 CTCTTAAAGGGTGAGCTGTATGG + Intergenic
1044879817 8:96712399-96712421 CTCTGCTAGGGTGATGTGGAAGG - Intronic
1045804562 8:106143434-106143456 CTCTTTAAAAGTTAGGTGGAGGG + Intergenic
1046718959 8:117597417-117597439 CCCTGTAAAGGGGATGTGGATGG - Intergenic
1047209990 8:122833432-122833454 CTCTTTAACAGTAATGCGGACGG + Intronic
1048520407 8:135148643-135148665 GTCTTTAAAGGTGAGGTAGAGGG - Intergenic
1050695544 9:8275730-8275752 CTCTGGTAGGGTGGTGTGGAAGG - Intergenic
1050945420 9:11511061-11511083 CTCTCTTAGGGCAATGTGGAAGG + Intergenic
1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
1051309817 9:15758000-15758022 CTCTGCTAGGGTGGTGTGGAAGG + Intronic
1052031235 9:23631266-23631288 CACTCTAAGGGAGATGAGGAGGG - Intergenic
1055056464 9:72028745-72028767 CTCTTTATGGGTGCTATGAAGGG + Intergenic
1057856500 9:98605023-98605045 GTCATTAGGGGTGATGTGGGTGG - Intronic
1062348558 9:136127367-136127389 CTCTGAAAGGGTGATGTGGAAGG - Intergenic
1189723578 X:43945962-43945984 CTTTTTAAGGGGGATCTGGCTGG + Intergenic
1195374143 X:104209718-104209740 CTCTTGAAGGGAGATCTGAATGG + Intergenic
1195545257 X:106106292-106106314 CTCTGTTAGGGTGGTGTGGAAGG + Intergenic
1196020648 X:110987399-110987421 CCCTTTAAGGGAGAAGAGGAAGG - Intronic
1196703549 X:118697185-118697207 CTCTGGAAGGCTGAGGTGGAAGG + Intergenic
1197848240 X:130827791-130827813 CTCTTTAAGTTTGATGATGATGG + Intronic
1201423351 Y:13823242-13823264 CTCTTTAAGTGTGAGGGGAAGGG - Intergenic
1201579890 Y:15500209-15500231 CTTTTTCTGGGTGCTGTGGAGGG + Intergenic
1201710254 Y:16984076-16984098 CTGTTTAAGGATGATGTTTAAGG + Intergenic