ID: 974951498

View in Genome Browser
Species Human (GRCh38)
Location 4:68588577-68588599
Sequence GGCTGAAATTCATTGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974951498_974951503 0 Left 974951498 4:68588577-68588599 CCAGCAATCAATGAATTTCAGCC 0: 1
1: 0
2: 1
3: 5
4: 117
Right 974951503 4:68588600-68588622 ACCTGAGTAGCTGGGGCTACAGG 0: 18
1: 1245
2: 46762
3: 167144
4: 225490
974951498_974951499 -9 Left 974951498 4:68588577-68588599 CCAGCAATCAATGAATTTCAGCC 0: 1
1: 0
2: 1
3: 5
4: 117
Right 974951499 4:68588591-68588613 ATTTCAGCCACCTGAGTAGCTGG No data
974951498_974951500 -8 Left 974951498 4:68588577-68588599 CCAGCAATCAATGAATTTCAGCC 0: 1
1: 0
2: 1
3: 5
4: 117
Right 974951500 4:68588592-68588614 TTTCAGCCACCTGAGTAGCTGGG 0: 2
1: 556
2: 14977
3: 127532
4: 226029
974951498_974951501 -7 Left 974951498 4:68588577-68588599 CCAGCAATCAATGAATTTCAGCC 0: 1
1: 0
2: 1
3: 5
4: 117
Right 974951501 4:68588593-68588615 TTCAGCCACCTGAGTAGCTGGGG 0: 4
1: 155
2: 2508
3: 4719
4: 6053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974951498 Original CRISPR GGCTGAAATTCATTGATTGC TGG (reversed) Intronic
905697019 1:39982013-39982035 TGCTGAAAGCCATAGATTGCTGG - Intergenic
905785270 1:40750922-40750944 GTCTGAAACTCATATATTGCTGG + Intronic
906775326 1:48524182-48524204 AGCTGAAATTCCATGATTCCAGG - Intergenic
909979733 1:82084393-82084415 GGATGGATTTCACTGATTGCTGG - Intergenic
910523251 1:88148119-88148141 GGCTGAATTTCATTTCTTACTGG - Intergenic
910725527 1:90334261-90334283 AGCAGACATTCATTGACTGCCGG + Intergenic
912565236 1:110582798-110582820 TCCTGAAATTCATTGTTAGCAGG + Intergenic
913691285 1:121282200-121282222 GGCTGGAATTCCTTGCTGGCTGG + Intronic
914146258 1:144997781-144997803 GGCTGGAATTCCTTGCTGGCTGG - Intronic
916834846 1:168532949-168532971 GGCTGAAATTCATAGACAGAAGG - Intergenic
920478609 1:206300676-206300698 GGCTGGAATTCCTTGCTGGCTGG + Intronic
921194006 1:212735383-212735405 GGCTGAATTTGTTTGATTTCTGG - Intronic
922382727 1:225048822-225048844 AACTGGAATTCATAGATTGCTGG - Intronic
924461511 1:244263638-244263660 GGCAGGAATTCATTGAAGGCAGG - Intergenic
1063392507 10:5659596-5659618 GGCTGAAATTCCTCGACTGAGGG + Intronic
1063495772 10:6506089-6506111 GGCTGAAATAGAGTGATTGCAGG - Intronic
1063849275 10:10165938-10165960 AGCTGGAATTCACTGATTGGGGG + Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066258561 10:33705910-33705932 GGTTGAAATTTATTGAGGGCAGG + Intergenic
1068076232 10:52258697-52258719 GGCAGAAATTCCTTGAGGGCAGG - Intronic
1070632287 10:78095324-78095346 GGCTGAGCTTCAGTGATAGCTGG - Intergenic
1071165489 10:82801485-82801507 GGCTGTAATTCATTGTTGGAGGG - Intronic
1071249282 10:83800446-83800468 GGCTGAAATACAATAATAGCAGG - Intergenic
1075067305 10:119297954-119297976 GCTTGAAATTCATTTATTGCTGG + Intronic
1077984117 11:7333160-7333182 GGCTGAAATTCACTAATTAAGGG + Intronic
1080303844 11:30815626-30815648 GCCTGAGATTCATTGATTATTGG - Intergenic
1081565073 11:44255598-44255620 GGCTGACATTTATTAAATGCTGG + Intergenic
1084315558 11:68343436-68343458 GGCTGAAATTCCTTGGTTCTTGG - Intronic
1085219710 11:74863309-74863331 GGCTGAAATACAGTGAATGAGGG - Intronic
1085811719 11:79688683-79688705 GTCTGAAACTCAATGATTTCTGG + Intergenic
1088108646 11:106235138-106235160 GGCTCACATTCTTTCATTGCTGG + Intergenic
1089807287 11:121102499-121102521 GGCTGAAATCCCCTGAATGCTGG - Intronic
1093287628 12:17284191-17284213 GGCTGAAAGTATTTGATTTCTGG - Intergenic
1098085990 12:66844609-66844631 TGCTGAAAACAATTGATTGCAGG + Intergenic
1102031483 12:109742382-109742404 GGATGAAAGTCCTTGACTGCAGG - Intronic
1103648076 12:122410972-122410994 AGCTGAACCTCATTCATTGCTGG + Intronic
1108231207 13:48343987-48344009 GGCTATAACTCATTGGTTGCTGG + Intronic
1108464999 13:50706564-50706586 AGCTGAATGTCATTGATTGAAGG - Intronic
1114787597 14:25619009-25619031 GGCTGAATTTAAATGATTTCTGG - Intergenic
1115441276 14:33438890-33438912 GGCTAAAATCCATTGCTTGTCGG - Intronic
1116342501 14:43742304-43742326 TGCTGAAATTCTCTTATTGCAGG + Intergenic
1120768275 14:88351863-88351885 AGCTGCAATTCAATGATTTCTGG + Intergenic
1124686918 15:31790754-31790776 GGCTGTCATTCATGGATTGAGGG - Intronic
1124891665 15:33739335-33739357 GACTGAAATTCATTTCTGGCTGG + Intronic
1129314419 15:74732582-74732604 GGGTGAACTTCATTGACTTCAGG - Intergenic
1131893556 15:97000826-97000848 GGCTGAATTTCATTGTCTGTAGG + Intergenic
1133514136 16:6491393-6491415 GGCAGAAATTCACTGAGTGTTGG - Intronic
1135251321 16:20902589-20902611 GGATGAGATTCACTGATTACGGG - Exonic
1135808935 16:25569860-25569882 GGCTGAAACTGATTGATCGTGGG - Intergenic
1142455720 16:90220553-90220575 GGTTGAAAATAATTGATTGGTGG + Intergenic
1143348681 17:6270508-6270530 GACTTTAAATCATTGATTGCTGG - Intergenic
1144877172 17:18404633-18404655 GGCTCAAATTCTTTGAATGAGGG - Intergenic
1145155058 17:20539773-20539795 GGCTCAAATTCTTTGAATGAGGG + Intergenic
1145853395 17:28126646-28126668 GTATCAAATTCATTGATTTCAGG + Intronic
1148480144 17:47954645-47954667 GCCTGGACATCATTGATTGCTGG + Intronic
1156194824 18:34762550-34762572 GGGTTAAGTTCATTGTTTGCTGG + Intronic
1157309913 18:46545037-46545059 GGCTGAATTTCATTGAAAGTTGG + Intronic
1159450273 18:68592348-68592370 AACTGAAATTCATAGATTGCTGG + Intergenic
1163466891 19:17473166-17473188 GGCTGAAATTGGGTGATCGCTGG - Intronic
1166957460 19:46474446-46474468 GGCTGAAATCCTTTGAAAGCTGG + Intergenic
929901737 2:46010322-46010344 GGAGGCAATTGATTGATTGCAGG + Exonic
935816686 2:106852587-106852609 TTCAGACATTCATTGATTGCAGG - Intronic
944353962 2:198763096-198763118 GTCTGAGATGCATTGTTTGCAGG + Intergenic
946171094 2:217896009-217896031 GGCAGACATTCATTGAGTGATGG - Intronic
946979114 2:225187695-225187717 GGCTGCAAATCATTGATTTGGGG - Intergenic
949087216 2:242165354-242165376 GGTTGAAAATAATTGATTGGTGG + Intergenic
1170960046 20:21017528-21017550 TGCTGGAATTCCTTCATTGCAGG + Intergenic
1179651095 21:42809361-42809383 AGCTGAAAATCATTGAGTTCAGG + Intergenic
1180259272 21:46657186-46657208 AGCTGAAAGTCATGCATTGCTGG + Intronic
1182558972 22:31144034-31144056 GGCTGGGTTTCATTGATGGCAGG - Intergenic
950449235 3:13056271-13056293 GGCTGAACTCCAAGGATTGCAGG - Intronic
950811146 3:15651145-15651167 ACCTGAAATTCATGGATTGAGGG + Intergenic
952229766 3:31417688-31417710 GTCTGATTTTGATTGATTGCTGG + Intergenic
953050181 3:39334463-39334485 GGCTGTTATTCATTGACTGATGG - Intergenic
956561587 3:70582959-70582981 GGCTGCCATTCATTCATAGCTGG + Intergenic
958824489 3:99014190-99014212 AACTGAAATTCATACATTGCTGG - Intergenic
963277009 3:143341965-143341987 AGCTGAGTTTCATTGATTCCGGG + Intronic
965736666 3:171827753-171827775 GTCTTAAATTCATTTAATGCAGG + Intergenic
969281168 4:6171501-6171523 GGCTGATGTTCTTTGATGGCTGG - Intronic
971017299 4:22501570-22501592 GCCTGTTATTCATTGACTGCAGG + Intronic
973580729 4:52341802-52341824 GGCTGACATTGATTGCCTGCAGG + Intergenic
974951498 4:68588577-68588599 GGCTGAAATTCATTGATTGCTGG - Intronic
975255109 4:72225308-72225330 GGTCTAAATTCAGTGATTGCAGG - Intergenic
975517891 4:75267173-75267195 GGCTGAAATCAGGTGATTGCTGG - Intergenic
981245612 4:142534032-142534054 GGCAGAAACTCATTGATCCCGGG + Intronic
986341609 5:6793884-6793906 GGCTGAGCTCCATTGATTGGAGG + Intergenic
987548474 5:19345942-19345964 GGATGAACTTCGTGGATTGCTGG - Intergenic
987747261 5:21992324-21992346 GACTGAAATAAATTGATTTCAGG + Intronic
991767437 5:70002110-70002132 GACTGAAATAAATTGATTTCAGG + Intergenic
991846672 5:70877187-70877209 GACTGAAATAAATTGATTTCAGG + Intergenic
994630424 5:102278141-102278163 GGCTGAAATTTAAAGATTGGGGG + Intronic
994736413 5:103562290-103562312 GGATGAAATTCGTTAATTGATGG - Intronic
994824004 5:104689708-104689730 GTCTGAAATGTATTGATTGGTGG - Intergenic
999848524 5:155512163-155512185 GTCTGAATGGCATTGATTGCAGG - Intergenic
1002084731 5:176766727-176766749 GACTGTAATTGATGGATTGCTGG - Intergenic
1004905620 6:20234694-20234716 GGCTGAGAGTCCTTGATTGCGGG - Intergenic
1005500788 6:26427332-26427354 GGCTGAAATGGAGTGAGTGCAGG + Intergenic
1005505357 6:26464652-26464674 GGCTGAAATGGAGTGAGTGCAGG + Intronic
1007417150 6:41698367-41698389 CGCTGAAACTCTTTGATCGCAGG - Intronic
1008640657 6:53459002-53459024 AGCTGAAACTTATTGATTACTGG + Intergenic
1011584163 6:88906512-88906534 AGCTGAAATGTTTTGATTGCAGG - Intronic
1013059229 6:106615681-106615703 GCCTGAAATTCATGTCTTGCCGG - Intronic
1013126171 6:107186891-107186913 TTGTGAAATTCATTTATTGCTGG - Intronic
1014257198 6:119173168-119173190 GGCTGGAACTCATGGATTGAAGG + Intergenic
1015740603 6:136449578-136449600 GGCTGATACTCGGTGATTGCTGG + Intronic
1018789525 6:167136236-167136258 CGCTGAAATTCATTGATTCCTGG - Exonic
1019898647 7:4002320-4002342 GGCTGAAATTCTTTGTTGTCTGG + Intronic
1022076408 7:26975199-26975221 GGGTGAAATTAATTGACTGTAGG - Intronic
1022625280 7:32029678-32029700 GGGTGAAAGTCATTGAATGTGGG - Intronic
1023201154 7:37698395-37698417 GGCTGAAAATCGTTGACTGATGG - Intronic
1030852455 7:114507565-114507587 GTCTGGAAGTCATTGCTTGCTGG + Intronic
1032462852 7:132124773-132124795 GGCTGAAAATCCTGGGTTGCGGG - Exonic
1035497510 8:65986-66008 GGTTGAAAATAATTGATTGGTGG - Intergenic
1043030405 8:75127439-75127461 GGCTGAAATTCAGTGTTGGCAGG - Intergenic
1044720039 8:95136020-95136042 GGGAGAAATTAATTGATTTCTGG - Intronic
1044759945 8:95507369-95507391 GGCTGAGATTCCTTGAGGGCAGG - Intergenic
1046115738 8:109781223-109781245 GGATGGATTTCACTGATTGCTGG + Intergenic
1046637328 8:116684674-116684696 GGCTAAAATTCAAAGATTGAAGG + Intronic
1055448649 9:76409742-76409764 GGCTGATTTTTATTGATTTCTGG + Intergenic
1056453269 9:86737020-86737042 GGCTGAAAGGCCTTGGTTGCTGG + Intergenic
1058930285 9:109712199-109712221 GGCCGAAGTTCATTGCTTACAGG + Intronic
1059475342 9:114542122-114542144 GGCTGAAATGAATTGCATGCTGG + Intergenic
1059586921 9:115617029-115617051 GGCTTAAATTTATCGGTTGCTGG + Intergenic
1197177604 X:123501928-123501950 GGCAGTAAATCATTGATTGAAGG - Intergenic