ID: 974951723

View in Genome Browser
Species Human (GRCh38)
Location 4:68591130-68591152
Sequence ATGGGTGAACAGCTCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974951715_974951723 21 Left 974951715 4:68591086-68591108 CCAGTGTGCACGATTTAGCCCAG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 974951723 4:68591130-68591152 ATGGGTGAACAGCTCCCAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 139
974951716_974951723 3 Left 974951716 4:68591104-68591126 CCCAGTAGCAATTATGCCAATCT 0: 1
1: 0
2: 1
3: 4
4: 111
Right 974951723 4:68591130-68591152 ATGGGTGAACAGCTCCCAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 139
974951717_974951723 2 Left 974951717 4:68591105-68591127 CCAGTAGCAATTATGCCAATCTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 974951723 4:68591130-68591152 ATGGGTGAACAGCTCCCAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974951723 Original CRISPR ATGGGTGAACAGCTCCCAGA AGG Intronic
904083264 1:27885458-27885480 AAGGGTGAGCAGCGCCCACAGGG - Intronic
906217682 1:44053391-44053413 ATGGGGGAACAGCTAAGAGAAGG - Intergenic
906739884 1:48172660-48172682 ATGGGGAGACACCTCCCAGAAGG - Intergenic
908026453 1:59957180-59957202 ATAGGTAACCAGCTCACAGAGGG + Intergenic
910964535 1:92794830-92794852 ATGTGTGAACAGCTCTGTGAAGG + Intergenic
912572365 1:110633840-110633862 ATGGGTGGGCAGCTCTGAGAGGG + Intergenic
915874201 1:159595085-159595107 AAGGGAGAAGAGGTCCCAGAGGG - Intergenic
919373584 1:196763444-196763466 ATGGGAGCCCAGTTCCCAGAAGG - Intergenic
919380024 1:196848121-196848143 ATGGGAGCCCAGTTCCCAGAAGG - Intronic
919927674 1:202200747-202200769 ATGGGAGAACAGGTCCCAGGAGG + Intronic
923252136 1:232187169-232187191 ATGGCAGAACAGCATCCAGATGG - Intergenic
1062921597 10:1284529-1284551 ATGTGTTAACAGTTCCCAGCAGG - Intronic
1069927366 10:71860134-71860156 AGATGTGAACAGATCCCAGAGGG - Intergenic
1070811479 10:79300333-79300355 CTGGGAGGACAGCTCCCAGCAGG + Intronic
1075029301 10:119011211-119011233 AAGGGTGAGCAGATCTCAGAAGG + Intergenic
1075067184 10:119297020-119297042 CTGGCTGGCCAGCTCCCAGAAGG - Intronic
1076468513 10:130702513-130702535 ATGTGTGCACAGCTGGCAGAGGG + Intergenic
1078884771 11:15489435-15489457 ATTGGTGAACAGCACCCAAGAGG + Intergenic
1079186835 11:18245698-18245720 CTGGATGAACAGCACCCAGAGGG + Intronic
1081649512 11:44814429-44814451 ATGTGTGAACCCCTTCCAGAAGG + Intronic
1088422766 11:109667438-109667460 ATGGGCCAACAGATTCCAGAAGG + Intergenic
1088751561 11:112846476-112846498 ATGGTTAGACAGCTTCCAGAAGG + Intergenic
1089128610 11:116194523-116194545 TTGTCTGGACAGCTCCCAGAGGG - Intergenic
1090990774 11:131815285-131815307 ACGGTGGGACAGCTCCCAGAAGG - Intronic
1091632345 12:2171458-2171480 ATGGTGGAAAAGCTCACAGACGG + Intronic
1095129949 12:38528930-38528952 TTGGGTGAACAGTTCCCATCTGG + Intergenic
1097186606 12:57199630-57199652 CTGGGTGCCCAGCCCCCAGAAGG + Intronic
1100620641 12:96269107-96269129 ATGGCTGCACAGCTCACTGAAGG + Exonic
1101583069 12:106061140-106061162 GTGGGAGAACAGCTCCCCAAAGG - Intergenic
1102986174 12:117280488-117280510 ATGGGAGAACAGTTCCCATCAGG + Intronic
1103736700 12:123065235-123065257 AAGGGTGAAGAGGTCCCCGATGG + Intronic
1104399842 12:128466223-128466245 CTGGGTCTGCAGCTCCCAGAGGG - Intronic
1106776785 13:33016703-33016725 GTGGGTGAACGTATCCCAGATGG - Exonic
1107415508 13:40196274-40196296 ATGGATAAGCAGCTCACAGAAGG + Intergenic
1108383873 13:49880078-49880100 ATGGGGGGACACCTCCCAGCAGG + Intergenic
1109982314 13:69924472-69924494 ATGAGTGTTCAGCTCTCAGAAGG - Intronic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110316515 13:74114741-74114763 ATGGGTGTTCATCTCACAGATGG + Intronic
1110389779 13:74960158-74960180 ATGGGAAGACACCTCCCAGAAGG + Intergenic
1112615184 13:100997339-100997361 ATGGAGGGACAGCTCCCAAAAGG - Intergenic
1116044137 14:39722230-39722252 ATGGGCGTCCAGCTCCCAGGAGG - Intergenic
1117033837 14:51705997-51706019 ATGGGTAAACAGCTACCTTATGG - Intronic
1117043538 14:51789898-51789920 ATGGGTACACAGTTCTCAGAAGG + Intergenic
1118773322 14:68956967-68956989 TTGGGTGAAGAGCTCCCTGTTGG - Intronic
1121228419 14:92338980-92339002 GTGGGGGCACAGCTCCCTGAGGG - Intronic
1122579571 14:102763059-102763081 ATGGGTGTCCAGCTGCCAGTGGG - Intergenic
1124165697 15:27323903-27323925 ATGGGTGAGCAGGTCCCACATGG + Intronic
1127267708 15:57375050-57375072 GTGTGTGAACAGTGCCCAGAGGG - Intergenic
1127373805 15:58363604-58363626 ATGGGGAGACAGCTCCCAGCAGG + Intronic
1127629392 15:60812854-60812876 ATAGGTGAACATCATCCAGAAGG + Intronic
1127996705 15:64157120-64157142 TGTGGTGAACAGCTCACAGAAGG + Exonic
1134230228 16:12423293-12423315 ATGACTGAACAGCTGCCTGATGG + Intronic
1136482145 16:30548711-30548733 ATGGGTGGACAGCACCAAGAAGG + Intronic
1138347486 16:56328900-56328922 ATGGGAGAACATCTCCCGGCAGG - Intronic
1138732572 16:59211200-59211222 AGGGAAGAACAGCTTCCAGAGGG + Intergenic
1140901028 16:79368030-79368052 CTGGCTGAACAGCTCCCTGAAGG + Intergenic
1141859158 16:86704724-86704746 CTGTGTGAACAGCTCCATGAGGG - Intergenic
1142192227 16:88723292-88723314 ATGGGTGACCAACGCCCAGGCGG - Exonic
1144410989 17:15001628-15001650 ATGGCTCAACACCTCCCACAAGG - Intergenic
1152153008 17:78614681-78614703 TTGGGAGAACAGCACCCAGGGGG - Intergenic
1152733549 17:81985571-81985593 ATGGCTGAGAAGCTCCCAGAGGG - Exonic
1153917184 18:9756768-9756790 ATGAATGAACAGCTCCTAAATGG + Intronic
1158748349 18:60227604-60227626 ATGGGGGAGCAGCTTCAAGATGG - Intergenic
1160058112 18:75505311-75505333 ATGGCTGAACAGATGCCAAAGGG + Intergenic
1160149089 18:76385781-76385803 ATGGGGGTACAGCTCCCGGGGGG - Intronic
1161938076 19:7384374-7384396 ATGGGCAAACAGATCCTAGATGG + Intronic
1164748861 19:30636303-30636325 ATGGGTGATCATCTCCCCCATGG + Intronic
927478879 2:23434816-23434838 AGGGGTGATCAGCTCACAGCTGG - Intronic
929409459 2:41680900-41680922 ATGGGTAAGCAACTCACAGAAGG - Intergenic
929851596 2:45596217-45596239 ATAGGTGCCCAGCTGCCAGAAGG - Intronic
929892737 2:45932038-45932060 CTGGGTGACCAGCATCCAGATGG + Intronic
932370949 2:71187324-71187346 ATAGCTGAAAAGATCCCAGAAGG + Exonic
936278982 2:111121988-111122010 CTGGGGCAACAGGTCCCAGAGGG - Intronic
940703422 2:157074627-157074649 ATGGGAGAAGAGCTACCAAAAGG + Intergenic
941516986 2:166492216-166492238 AGGGGTCATCAGATCCCAGATGG - Intronic
1175908269 20:62392418-62392440 ATGGGGGAACTTCTCCCTGAAGG + Exonic
1176309160 21:5140676-5140698 AGGAGAGAACAGCTCCCCGAGGG - Intronic
1178291038 21:31368608-31368630 ATGCGTGAACAGATCCCAAAAGG + Intronic
1178635467 21:34298441-34298463 ATGGATGAAAACCTCCCTGATGG - Intergenic
1179725487 21:43339305-43339327 AAGGGTGACCTGCCCCCAGATGG - Intergenic
1179847901 21:44121357-44121379 AGGAGAGAACAGCTCCCCGAGGG + Intronic
1181831477 22:25564302-25564324 ACCGGTGAACAGCGCCCAGCGGG - Intergenic
1182091955 22:27602081-27602103 ATGTGCTCACAGCTCCCAGATGG + Intergenic
1182351745 22:29703625-29703647 TTGGGAGAGCAGCTCCCAGCTGG + Intergenic
1183819106 22:40330357-40330379 AGGTGTGTACAACTCCCAGAGGG + Exonic
1184535385 22:45083066-45083088 ATGGGTGAGCACCACCCAGGCGG - Intergenic
1184669070 22:46003414-46003436 ATGAGTGAGCAGCACCCAGGAGG + Intergenic
949864201 3:8533757-8533779 ATGGGGCAACAACTACCAGATGG + Intronic
952971906 3:38656642-38656664 TTGGGTGAGCAGCTCCCATGAGG + Intergenic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
959187018 3:103057349-103057371 AAGGGTGGGCAGCTCCCAGAGGG + Intergenic
959747598 3:109795459-109795481 ATGGGGAAACACCTCCCAGCAGG + Intergenic
961617571 3:128194996-128195018 CTGGCTGACCAGCTCCAAGAAGG - Intronic
962482825 3:135812313-135812335 ATGGATGCTCAGCTCCCAAAGGG + Intergenic
962958963 3:140292252-140292274 ATGAGGCAACAGCTCCCAGGAGG - Intronic
963443222 3:145367744-145367766 TTTGGTGGAAAGCTCCCAGAAGG + Intergenic
964472018 3:157066160-157066182 ATGGCTGAACAGGTTGCAGAGGG - Intergenic
967888019 3:194346303-194346325 ATGGGGGCACAGCCTCCAGACGG + Intronic
968525229 4:1053599-1053621 AAGGGTAGTCAGCTCCCAGAGGG + Intergenic
969243276 4:5916064-5916086 ATGGGTGTGCAGCTACCACAGGG + Intronic
969437829 4:7198934-7198956 ATGGGTTGAGAGCTCCCAGCAGG + Intronic
970005295 4:11405182-11405204 ATGGGTTAATAGGTCCCAAAGGG + Intronic
972819152 4:42679612-42679634 ATGGGTGTACAGTTCCAGGAGGG - Intergenic
972891144 4:43557684-43557706 ATGGGTGTGCATCTCCCAGTAGG + Intergenic
974951723 4:68591130-68591152 ATGGGTGAACAGCTCCCAGAAGG + Intronic
975294068 4:72711921-72711943 ATTGGGGAAGAACTCCCAGAAGG - Intergenic
976211559 4:82676568-82676590 TTGGGAGAACAGATCCCAGGAGG + Intronic
977458953 4:97300045-97300067 ATGGGTGTGCATCTCCCAGAAGG - Intronic
978580674 4:110228541-110228563 ATGGGGAAGCAGATCCCAGATGG + Intergenic
981933229 4:150211949-150211971 ATGTGTCATCAGCTACCAGATGG + Intronic
983120457 4:163877751-163877773 ATGGGTGAGGAGATCCAAGATGG - Intronic
983380117 4:166981395-166981417 ATGAGTGTCCAGCTCTCAGAGGG + Intronic
984874210 4:184352997-184353019 ATGGCTGGACAGCACCCACAGGG + Intergenic
985681606 5:1258641-1258663 CTAGGTGAACAGCCTCCAGACGG - Exonic
986110434 5:4710347-4710369 ATGGGGAGACACCTCCCAGAAGG + Intergenic
992288753 5:75262983-75263005 AAGGGTGAATAGCTCTCAGTAGG - Intergenic
993609087 5:90032211-90032233 ATGGGGGGACACCTCCCAGGAGG + Intergenic
994344592 5:98669283-98669305 ATGGGTGAAAACCTCCAACAGGG + Intergenic
996321932 5:122228739-122228761 ATGGGAAAATAGCTTCCAGATGG + Intergenic
1001547147 5:172577445-172577467 AAGGATGAGCAGTTCCCAGAAGG + Intergenic
1008982283 6:57498736-57498758 TTGGGTGAACAGTTCAGAGAAGG + Intronic
1009170350 6:60391577-60391599 TTGGGTGAACAGTTCAGAGAAGG + Intergenic
1010302483 6:74278186-74278208 AGGGATCATCAGCTCCCAGAAGG - Intergenic
1027162268 7:75811549-75811571 CTGGGTGAGAAGATCCCAGAAGG - Intergenic
1029748110 7:102528015-102528037 AGGGGTGACCAGCCCACAGAGGG - Intergenic
1029766057 7:102627102-102627124 AGGGGTGAGCAGCCCACAGAGGG - Intronic
1030038043 7:105424794-105424816 ATGAGTGAATCCCTCCCAGAAGG + Intergenic
1030294376 7:107906855-107906877 ATGTGTGGAAAGCTGCCAGATGG - Intronic
1030297538 7:107944019-107944041 ATGGGTGAGTAGGCCCCAGAGGG - Intronic
1030696839 7:112594647-112594669 TTAGCTGAGCAGCTCCCAGATGG + Intergenic
1033241594 7:139684227-139684249 ATGGGGGAACAGCTCATAGATGG - Intronic
1035466574 7:159083409-159083431 ATGAGGAAACTGCTCCCAGAAGG - Intronic
1035740388 8:1923837-1923859 CTGGGTCAACAGCTTACAGATGG + Exonic
1037285771 8:17298129-17298151 AAGAGTGGACAGCTCCAAGAAGG + Exonic
1037498155 8:19460823-19460845 TAGGATGAAAAGCTCCCAGAAGG - Intronic
1042724333 8:71856744-71856766 ATGGCTGAAAAGTTCCCATATGG - Intronic
1048547927 8:135404562-135404584 ATGAGTGTACAGCTCTCAGCAGG + Intergenic
1049040645 8:140110180-140110202 ATGGGGGAGCTGCTGCCAGAGGG - Intronic
1049158513 8:141082379-141082401 ATGGCTGAACAGGTCCCTGGAGG - Intergenic
1049430474 8:142560822-142560844 ATGGGTGCACAGCACCGGGATGG - Intergenic
1051582300 9:18690120-18690142 ATCTGTGAACAGAACCCAGAAGG + Intronic
1056093797 9:83230764-83230786 ATGGGGGAACAGCTGGCAGCTGG + Intergenic
1060204732 9:121675785-121675807 ATGGGTGACAGCCTCCCAGAGGG + Intronic
1062273232 9:135719253-135719275 AGGGGTTAACAGCCCCCAAAGGG + Intronic
1062394914 9:136348915-136348937 ATGGGTGAGCAGGTGGCAGATGG - Intronic
1186490318 X:9967255-9967277 ATGGGTGAGTAGCGCCAAGAGGG - Intergenic
1187061822 X:15793871-15793893 ATGGGTAAACATTACCCAGAAGG + Intronic
1189446837 X:41087337-41087359 AAGGGTAATCAGCTCCGAGAGGG - Intronic
1189923865 X:45932462-45932484 CTGGGTGATAAGCTCCCAAAGGG - Intergenic
1198130839 X:133693676-133693698 ATCTGAGAACAACTCCCAGAAGG - Intronic