ID: 974951844

View in Genome Browser
Species Human (GRCh38)
Location 4:68592331-68592353
Sequence CAAAATATGAAAATCCTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974951844_974951845 -1 Left 974951844 4:68592331-68592353 CCTGGTAGGATTTTCATATTTTG 0: 1
1: 0
2: 3
3: 28
4: 316
Right 974951845 4:68592353-68592375 GTTATCCACATGTTGTACAGTGG No data
974951844_974951848 21 Left 974951844 4:68592331-68592353 CCTGGTAGGATTTTCATATTTTG 0: 1
1: 0
2: 3
3: 28
4: 316
Right 974951848 4:68592375-68592397 GAAGAAAAACAATGAATTTTGGG No data
974951844_974951847 20 Left 974951844 4:68592331-68592353 CCTGGTAGGATTTTCATATTTTG 0: 1
1: 0
2: 3
3: 28
4: 316
Right 974951847 4:68592374-68592396 GGAAGAAAAACAATGAATTTTGG 0: 1
1: 1
2: 9
3: 97
4: 819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974951844 Original CRISPR CAAAATATGAAAATCCTACC AGG (reversed) Intronic
903407921 1:23114333-23114355 AAAATTATTAAAATCCTTCCTGG - Intronic
903989017 1:27252048-27252070 AAAAATAAAAAAAACCTACCAGG + Intronic
905886077 1:41492867-41492889 CATCCTATGAAAATTCTACCTGG - Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907853652 1:58280616-58280638 CAGAATTTCTAAATCCTACCTGG + Intronic
908824073 1:68116605-68116627 CAAGTGATTAAAATCCTACCTGG + Intronic
910107402 1:83646301-83646323 CAAAAAATGCAAATACTAGCTGG + Intergenic
911557825 1:99366945-99366967 CAAAATATGAAAATCCAGAAAGG - Intergenic
911563117 1:99430735-99430757 CAGAGTATGGAAATCCTAGCTGG + Intergenic
912364287 1:109120234-109120256 CAAAAAATGCAAAACCTAGCTGG + Intronic
912857519 1:113183515-113183537 CAAACTATAAAAATCCTAGAAGG + Intergenic
915005766 1:152634536-152634558 CAAAATATGAAACTACTATAAGG + Intergenic
916379573 1:164194997-164195019 CAAACTATGAAACTACTACAAGG + Intergenic
917465378 1:175271425-175271447 CAAAACATACAGATCCTACCAGG - Intergenic
917555187 1:176078524-176078546 CAAACTATAAAAATCCTAGAAGG + Intronic
918496232 1:185140614-185140636 CAAAATATGAAAAACTTTTCTGG + Intronic
920874565 1:209822188-209822210 CAAAATATGATAATTATACCAGG + Intergenic
921153959 1:212423864-212423886 CAAAATATGCAAATCCTGCCAGG - Intergenic
923096126 1:230776641-230776663 CAGAATATGAACATCCTCCCTGG - Intronic
1063239330 10:4152126-4152148 CAAAATATACAAATCCAACATGG - Intergenic
1064386526 10:14897314-14897336 CAACAAATTAAAATCCCACCTGG + Exonic
1064386808 10:14901667-14901689 CAAAATATGAAAAAACTAGCCGG + Intronic
1064664572 10:17637756-17637778 CAAAGTATGAAACTCTTAACAGG - Intergenic
1065538678 10:26739417-26739439 CAAAATATCAAACTCTTCCCCGG - Intronic
1067359696 10:45567386-45567408 CAAACTATGAAACTACTACAAGG - Intronic
1068752559 10:60612049-60612071 TAAAATATTAAAATCCTCCTGGG - Intronic
1069975228 10:72207489-72207511 CATAAGAGGAAATTCCTACCAGG + Intronic
1070123298 10:73599120-73599142 AAAAATAAGAATAACCTACCAGG + Intronic
1071083155 10:81837067-81837089 CAAATGATGAAAATCTTACTAGG - Intergenic
1071356718 10:84804313-84804335 CAAAATATCAAAATATTATCAGG + Intergenic
1071985840 10:91049423-91049445 CATGATATGAAAAAGCTACCTGG + Intergenic
1074924418 10:118052995-118053017 TAGAATATTAAAATACTACCTGG - Intergenic
1077634129 11:3830491-3830513 CAAAAAATGAAAAAATTACCAGG + Intronic
1077649704 11:3959070-3959092 CCAAATTTGAAAATCTTCCCAGG + Intronic
1078234851 11:9475046-9475068 CAAAAAATGAAAAAACTAGCTGG - Intronic
1078300013 11:10119835-10119857 CAAAATTTAAAAAGCCTCCCAGG - Intronic
1079640157 11:22795276-22795298 CTAAATATGACAACCCTAGCTGG + Intronic
1079776645 11:24540126-24540148 AAAAATATGAAAATCCAAAGTGG - Intronic
1079954192 11:26842403-26842425 CAAAATGTGCAAATCCTACAGGG - Intergenic
1080700774 11:34642215-34642237 CAAACAATGAAAATCCAAGCTGG - Intronic
1081314714 11:41617755-41617777 GAAAATATGGAAATCATTCCTGG + Intergenic
1082015951 11:47487160-47487182 CACAACATGAAAGTCCTCCCAGG - Exonic
1083444650 11:62699653-62699675 CAACATAGCAAAATCCTATCTGG + Intronic
1083675104 11:64320823-64320845 CACAAGAAGAATATCCTACCTGG - Intronic
1084071525 11:66739426-66739448 TAAAATAGGAAAATTCTCCCAGG + Intergenic
1085139004 11:74122800-74122822 CAAAATATTCAAATCCTACTAGG + Intronic
1085203816 11:74718235-74718257 CAGAAGAAGAAAATCCTTCCAGG + Intronic
1086271340 11:85070454-85070476 GAAAATATGAAAAACCTACTCGG + Intronic
1086328046 11:85724795-85724817 CAAAATATGAAAGTGATACAGGG - Intronic
1087184754 11:95177431-95177453 CCAAATTTGAGAATCCTTCCTGG - Intronic
1087339965 11:96891913-96891935 CAAAATATGATATTCATTCCAGG + Intergenic
1088792323 11:113236750-113236772 GCAAATATGAAAATCCTTTCAGG - Intronic
1089733414 11:120533714-120533736 CAAAAAATGCAAAACTTACCCGG + Intronic
1090261614 11:125325027-125325049 CCAAATAAGAAAATCCTGCTGGG + Intronic
1092268629 12:7003509-7003531 TAAAATTTGAAAACCCAACCTGG - Intronic
1092858907 12:12701767-12701789 CAAAATATGAAAACTTTAGCTGG + Intergenic
1093844133 12:23947706-23947728 AAAAAAATGAAATTCCCACCAGG + Intronic
1094305866 12:29018477-29018499 TTGAATATGAACATCCTACCAGG + Intergenic
1095466842 12:42496533-42496555 CAAGCTATGAAAATCCTAGATGG + Intronic
1097447558 12:59691111-59691133 CAAAATATATAAATCATACATGG + Intronic
1099335797 12:81355512-81355534 CTATATATGAAAGTCCTAGCTGG + Intronic
1100539130 12:95541416-95541438 CAAAATATGCAAAATTTACCTGG + Intronic
1101164927 12:102019293-102019315 GAAAATATGAATATCCCGCCTGG - Intronic
1101869153 12:108548201-108548223 CAAAATATAAAATGCCTAACAGG - Intronic
1104853275 12:131889099-131889121 CAAAATATGAAAAAATTAGCTGG + Intergenic
1105312901 13:19229164-19229186 CTATATCTGAAAACCCTACCTGG + Intergenic
1105342181 13:19537762-19537784 AAAAATATTAAAAACCTAGCTGG - Intergenic
1105489057 13:20869942-20869964 AAAAATATGAAAATATTAGCCGG + Intronic
1105820771 13:24078971-24078993 CAATATATGAAATTCCAACTGGG + Intronic
1107355782 13:39564843-39564865 CAAAATTTGAAAATGCTAATGGG + Intronic
1107694314 13:42985738-42985760 CAAAACAATAAAATCCAACCGGG + Intronic
1108812287 13:54242502-54242524 AAAAATATGCAAAGCCTACCAGG - Intergenic
1108821582 13:54357382-54357404 CAAAACATGAAAAGCCTAGGGGG + Intergenic
1109780355 13:67103186-67103208 AAAAATATAAAAATGCTACAAGG + Intronic
1110875622 13:80506158-80506180 CAAACTATAAAAATCCTAAAAGG - Intergenic
1111839991 13:93437845-93437867 CTAAATATGAAAGTCTTACATGG - Intronic
1114052551 14:18933352-18933374 CAAACTATAAAAGTCCTACAAGG - Intergenic
1114110006 14:19468573-19468595 CAAACTATAAAAGTCCTACAAGG + Intergenic
1115689834 14:35831099-35831121 CAAAATATAAAAATATTAGCTGG - Intronic
1116745938 14:48818599-48818621 AAAAATATGAAAATGCCACACGG + Intergenic
1117961014 14:61161520-61161542 CAAATTATGTAAATCATGCCTGG - Intergenic
1118476476 14:66121885-66121907 CAAACTAAGAAAATCCTTCCAGG + Intergenic
1119339939 14:73868506-73868528 AAAAATAAGCAAATCCTGCCAGG - Intronic
1120316974 14:82906713-82906735 CAAATAATGAAAATGCCACCCGG - Intergenic
1121545533 14:94760505-94760527 CAAAATGAGAAAATCATAGCTGG - Intergenic
1121998911 14:98629942-98629964 CAAAATGTCAAAATCCTTCTAGG + Intergenic
1123136201 14:106029702-106029724 AAAAATATGAAAAACTTAGCTGG + Intergenic
1123820530 15:24026079-24026101 AAAAATATGAAAAACTTAGCTGG - Intergenic
1124213942 15:27790948-27790970 CAAAAAATGAAAAACTTAGCTGG - Intronic
1124704367 15:31949880-31949902 CAAATTATAAAAATCCTAGAAGG - Intergenic
1125459931 15:39896218-39896240 CAAAAAATGAAAATACTAGCTGG - Intronic
1126528461 15:49685381-49685403 CAATATAGGAAACTCCTGCCAGG + Intergenic
1127886217 15:63203409-63203431 CAAAAAATAAAAGTCCTACAAGG - Intronic
1130843349 15:87722505-87722527 TAAGTGATGAAAATCCTACCTGG - Intergenic
1131007691 15:88991736-88991758 CAAAAAATGTAAATACTAGCTGG + Intergenic
1133053593 16:3133419-3133441 TAAAATATGAAAATTCCGCCAGG + Intronic
1133941699 16:10314675-10314697 GAGAATATGAAAATAATACCCGG + Intergenic
1134206917 16:12246013-12246035 CAAAAGGTTAACATCCTACCTGG + Intronic
1137268974 16:46890328-46890350 CACAATGTGAAAATGCTCCCGGG - Intronic
1137645423 16:50069161-50069183 CAAAACATGAAAATAATACCTGG - Intronic
1139746391 16:69078108-69078130 CAAAATATTAATAGCCTCCCAGG + Intronic
1140278925 16:73536306-73536328 CAAAATATGAAGTTCACACCAGG + Intergenic
1142793644 17:2289393-2289415 CAAAAAATCAAAATATTACCTGG + Intronic
1143048268 17:4100510-4100532 CAAAATATTCAAATCAGACCAGG + Intronic
1144089670 17:11844321-11844343 CAAAATATCAAAATACAATCTGG - Intronic
1144265903 17:13569226-13569248 CAAAGTAAGGAAATCCTGCCAGG - Intronic
1148932785 17:51140672-51140694 AAAAATAAAAAAATCCTCCCGGG + Intergenic
1149802914 17:59587383-59587405 CAAAATATAAAAAAATTACCTGG - Intronic
1149843572 17:59988095-59988117 CAAAATATAAAAAAATTACCTGG + Intergenic
1151441496 17:74132231-74132253 TAAAATCTGAACATCCTTCCTGG - Intergenic
1152081402 17:78189677-78189699 AAAAATATGAAAAATCAACCGGG - Intronic
1153412118 18:4804909-4804931 TAAAATATGTATATCTTACCTGG - Intergenic
1154341555 18:13506683-13506705 CCAGCTATGAAAATCCTACATGG - Intronic
1155015822 18:21838103-21838125 CAAAATATCAAAAAGCTAGCTGG + Intronic
1155830134 18:30505810-30505832 CTAAATATGACAGTCCTAGCAGG + Intergenic
1156030696 18:32708853-32708875 CAAAATTTCAAAATCCCATCAGG - Intronic
1156232717 18:35170063-35170085 CAAAATGTGAATATCTAACCAGG - Intergenic
1159041648 18:63329136-63329158 CAAAACATGAAAATATTACAAGG - Exonic
1159390883 18:67790291-67790313 CAAAAAATGAAAATATTAGCTGG - Intergenic
1161675514 19:5646012-5646034 ACAAATATAAAAATCATACCTGG - Intronic
1164049789 19:21575712-21575734 CAAAATAGGAAATCACTACCAGG - Intergenic
1164744323 19:30599841-30599863 CAAAAGATGAAAATCCTGTGAGG - Intronic
1164915932 19:32052436-32052458 CCAGATATCAAATTCCTACCTGG - Intergenic
1165233317 19:34401187-34401209 CAAAAAATGAAAAAACTAGCAGG - Exonic
1165883017 19:39056825-39056847 AAAAATTGGAAAAACCTACCCGG - Intergenic
1168305939 19:55435983-55436005 CACAATATGAAAATCGTTTCTGG + Intronic
1168585130 19:57585575-57585597 CAAAATCTGAAAATGCAAGCAGG - Intronic
927042407 2:19242625-19242647 CAAAAAATGAAATTTCAACCAGG + Intergenic
928923418 2:36550852-36550874 CATATTATGAAAATACTAACAGG + Exonic
930802666 2:55458996-55459018 CAAAAAATGAAATGCCTACATGG + Intergenic
931549706 2:63429226-63429248 CAAACTATAAATATCCTACAAGG + Intronic
933319293 2:80753219-80753241 AAAAATATGAAAATCATAAAGGG - Intergenic
935488911 2:103693391-103693413 CAAAAAATGAAAATATTAGCTGG - Intergenic
935615307 2:105073363-105073385 CAACTTAAGATAATCCTACCAGG - Intronic
936561533 2:113542791-113542813 CAAAATATTAAAAACCTTCAGGG - Intergenic
937621207 2:123989611-123989633 CAATATATGAGAATTCTAGCTGG - Intergenic
938171677 2:129083059-129083081 GAAAATAAAAAAATCCTACAAGG - Intergenic
938622819 2:133074519-133074541 AAAAATATGAAAAAACTAGCTGG - Intronic
939301022 2:140338637-140338659 CATAATATGAAGATCCAACAGGG - Intronic
939912967 2:148005812-148005834 CAAAATATGAAAAAATTAGCTGG + Intronic
940383948 2:153048499-153048521 CAAACTATAAGAATCCTACAAGG + Intergenic
940930315 2:159421334-159421356 CAAAAAATAAAAATATTACCTGG - Intronic
941147635 2:161872007-161872029 CAAAATATGTAAATGTTACCAGG - Intronic
943317505 2:186408608-186408630 AGAAAAATGAGAATCCTACCAGG + Intergenic
943724875 2:191243408-191243430 CAACATATGAACCTGCTACCTGG - Intergenic
944055527 2:195518338-195518360 AAAAATAAGAAAAACCTAACTGG - Intergenic
944216892 2:197265163-197265185 TAAAATAAGAAAAAGCTACCTGG - Intronic
944993860 2:205271261-205271283 CAAAATATCAGATTGCTACCAGG + Intronic
945962772 2:216152807-216152829 CAAAATATAAAAAACTTAGCCGG - Intronic
947240503 2:227989414-227989436 TAAGACATGAAAATCCTACCTGG + Intronic
947616707 2:231562378-231562400 CAAAATATGAAAGTATTACATGG - Intergenic
948418003 2:237830921-237830943 CAAAAAAAAAAAATCCTACTTGG + Intronic
948812568 2:240490695-240490717 TAAAAGATCAAAATCATACCAGG - Intronic
1169715026 20:8606324-8606346 CAAAATAAGATTATCCAACCAGG + Intronic
1169805738 20:9557589-9557611 CCAAACATGAACATCTTACCCGG + Exonic
1169838808 20:9911169-9911191 CAAACTATAAAAATCCTAGAAGG - Intergenic
1170743215 20:19075776-19075798 TAAAATAAAAAAATCCTTCCAGG - Intergenic
1171900392 20:30850997-30851019 AAATATATGCAAATCCTACCTGG - Intergenic
1173463526 20:43262951-43262973 CCAAATATGAATTTCCTGCCAGG - Intergenic
1173831998 20:46095834-46095856 CAAAACATGAAAAAACTAGCTGG + Intergenic
1175317677 20:58061322-58061344 CAAAATATGTAAATATTAGCTGG + Intergenic
1177158524 21:17522958-17522980 AAAAATATGAATATCTTACTTGG + Intronic
1179271595 21:39855617-39855639 CAAAATATGAAATTCACATCTGG - Intergenic
1180191143 21:46163274-46163296 AAAAAAATGAAAAGCCAACCCGG - Intronic
1180321290 22:11323756-11323778 AAATATATGCAAATCCTGCCTGG + Intergenic
1180333753 22:11556988-11557010 AAATATATGCAAATCCTACCTGG - Intergenic
1180471026 22:15655727-15655749 CAAACTATAAAAGTCCTACAAGG - Intergenic
1183533244 22:38375860-38375882 CTAAATATGAAAGTCCTAGATGG + Intronic
949363801 3:3259149-3259171 CAACATATGAGAATGGTACCAGG + Intergenic
949461147 3:4296197-4296219 CAAAATAAGAAATTTCTATCTGG - Intronic
949698988 3:6734051-6734073 CATAATTTGAATATCATACCAGG + Intergenic
949843074 3:8341043-8341065 CAAAAAATGAAAAAACTAGCAGG + Intergenic
950633056 3:14296870-14296892 CAAAATATGAAAAAACTTCATGG + Intergenic
951060217 3:18197865-18197887 CAAACTATGAAAATTCTAGAAGG - Intronic
951140404 3:19151576-19151598 CATCATCTGAAAATCCTCCCAGG + Intronic
951576012 3:24114820-24114842 CAAAAGATGAATAACCTGCCAGG - Intergenic
952106569 3:30077098-30077120 CAAAATATTAAACTCCTTCTAGG + Intergenic
952376684 3:32773376-32773398 CAAGACATGAAAATCCTGCTGGG - Intronic
952753796 3:36848289-36848311 AAAAATGTGAAAATCCTTCTTGG + Intronic
953091772 3:39734364-39734386 GAAAAAATGAACAACCTACCAGG + Intergenic
955081742 3:55664164-55664186 CTAAATCTGATAACCCTACCTGG + Intronic
957088514 3:75705885-75705907 AAATATATGCAAATCCTGCCTGG - Intergenic
958038836 3:88202015-88202037 CAAAATATTAAAATATTAGCTGG + Intergenic
958159743 3:89803145-89803167 CAAAATGTGAAAAGACTACAAGG - Intergenic
958443089 3:94180146-94180168 GAAACTAGGAAAATCCTAGCTGG - Intergenic
959388973 3:105749313-105749335 CATAAAATGAAAATCTTACCTGG - Intronic
959466326 3:106692007-106692029 CTAAATAAGAAACTCATACCAGG + Intergenic
960113204 3:113865808-113865830 CTGTATATGAAAATCCTCCCTGG - Intronic
960459458 3:117915400-117915422 CAAAAGATGAAAATACTAAATGG - Intergenic
960490064 3:118306476-118306498 CAATATATAATAATCATACCAGG - Intergenic
960561457 3:119088195-119088217 AAAAAAATTAAAATCATACCAGG + Intronic
961364684 3:126391856-126391878 CAAAATATAAAAAGCATGCCAGG + Intergenic
961790488 3:129372585-129372607 CAAAATAAAATAATTCTACCAGG - Intergenic
961909821 3:130302861-130302883 GAAAGGATGAAAATCCTACTCGG + Intergenic
961947006 3:130701614-130701636 CAAAATTTGACCATCATACCAGG - Intronic
963553594 3:146757377-146757399 CAAAATGTAAAAATGCTCCCAGG - Intergenic
963846880 3:150168150-150168172 AAAAATATGAAAAAGCCACCAGG + Intergenic
964410854 3:156396369-156396391 CAAAATATTAATATCCAACAGGG + Intronic
965174578 3:165315423-165315445 CAAAATATGAAACTACTAAAAGG - Intergenic
966133234 3:176668194-176668216 CAAAATAAGGAAATCGTACACGG - Intergenic
966193056 3:177288576-177288598 CAAAAAATGCAAAACTTACCTGG + Intergenic
966544374 3:181128573-181128595 GACAATATGAAAATTGTACCAGG + Intergenic
967378426 3:188831136-188831158 TAAAATATGGAACTCTTACCAGG - Intronic
967660250 3:192099014-192099036 CAAAACATGAAAATTTTAGCTGG - Intergenic
968309299 3:197669722-197669744 CAAAATACGTAAATTCTCCCAGG - Intergenic
968357258 3:198119058-198119080 AAATATATGCAAATCCTGCCTGG - Intergenic
971723588 4:30279237-30279259 CACAATTTGAAAATCTTAGCTGG - Intergenic
972112840 4:35587036-35587058 CAAACTAAGAAAATCACACCTGG - Intergenic
972540226 4:40032580-40032602 CAAAATATGCAAAATTTACCTGG - Intergenic
973327003 4:48872474-48872496 CAAAAAATGTAAAACTTACCTGG - Intergenic
973808233 4:54545955-54545977 CAAAGTAGAAAAATCCTAGCAGG - Intergenic
974260936 4:59522600-59522622 CAAAATATGAACAACCAACCAGG + Intergenic
974632300 4:64509185-64509207 AAAATTATAAAAATCCTACTTGG - Intergenic
974951844 4:68592331-68592353 CAAAATATGAAAATCCTACCAGG - Intronic
975432021 4:74304722-74304744 CAAAAAATGAAAAACTTAGCTGG - Intergenic
975850883 4:78571170-78571192 CAAAATATTAAAAAATTACCAGG - Intronic
976855684 4:89602740-89602762 CAAAATATGCAAATCCTGAGAGG + Intergenic
977432856 4:96953971-96953993 CTAAATGTGACAACCCTACCTGG - Intergenic
977459292 4:97304741-97304763 CAATAAATGGAAATCATACCAGG - Intronic
978084353 4:104632124-104632146 TAAAATATGAAAACCCTATATGG + Intergenic
980688742 4:136263498-136263520 TAAAAAATCAAAATCATACCAGG + Intergenic
981732271 4:147912242-147912264 AAATATATGAAATTCCTTCCAGG + Intronic
983674970 4:170281513-170281535 CAAAATCTGACAATCCTAGGAGG - Intergenic
986150317 5:5122718-5122740 CAAATTATGAAATTCCAACTTGG - Intergenic
986313167 5:6569798-6569820 TAAAATATGAAAAGACTACACGG + Intergenic
987579230 5:19767113-19767135 AAAAATATTAAAATAATACCAGG + Intronic
987952161 5:24688989-24689011 CAAACTATGAAACTACTACAAGG + Intergenic
990112161 5:52340075-52340097 CAAGCTATGAAAATCCTAGATGG - Intergenic
990236599 5:53775389-53775411 AAAAATATCATAAACCTACCAGG + Intergenic
990415100 5:55578839-55578861 CAAGCTATGAAAATCCAGCCTGG + Intergenic
991579153 5:68136128-68136150 CAAAATATGAAAGTCATCACTGG + Intergenic
991659950 5:68940836-68940858 CAAACTATAAGAATCCTACAAGG + Intergenic
992262354 5:74984205-74984227 CAAACAATGAAAATTCTAGCTGG + Intergenic
992554482 5:77889872-77889894 CATTATATGAAAATACCACCAGG - Intergenic
993191200 5:84684100-84684122 CAAAATATAAAAGTCTTAACAGG - Intergenic
993853981 5:93049337-93049359 CAAAATAGGCAAATCCTTACAGG + Intergenic
994048559 5:95336589-95336611 CAAAATAGGATAATCATACTAGG + Intergenic
994667432 5:102722848-102722870 CAAAGTATGAAGAGCCTAACAGG + Intergenic
994725752 5:103433492-103433514 CAAAATATGAAAATGCCATTTGG + Intergenic
994801459 5:104382501-104382523 TAAAATATGAAAATGAAACCTGG + Intergenic
994934806 5:106240464-106240486 AAAAATATGAATTTCCTACCGGG - Intergenic
995179955 5:109221767-109221789 AAAAATTTGAAAAACCTACTTGG - Intergenic
996653125 5:125905960-125905982 CAAAATATGAAAATGTTAAGTGG - Intergenic
997325728 5:133019241-133019263 TAAAATATGTTAATCATACCTGG - Intronic
998013550 5:138714603-138714625 CAAAAAATTAAAAAACTACCTGG - Intronic
999514965 5:152292073-152292095 CTAACTATGAAAATCCTAGATGG - Intergenic
1000092399 5:157941085-157941107 CAAAATATAAAAATCCAAGTGGG - Intergenic
1001964816 5:175902761-175902783 AAAAATATGAAAAACCAGCCTGG + Intergenic
1002252136 5:177936427-177936449 AAAAATATGAAAAACCAGCCTGG - Intergenic
1006857270 6:37143382-37143404 GAAAATACAAAAATCCTACATGG + Intergenic
1007010308 6:38410617-38410639 GAAAACATGAAAATATTACCTGG + Intronic
1008130031 6:47710674-47710696 CAAAATGTGGAAATCCTAATTGG + Intronic
1008471432 6:51889425-51889447 CTAAATATGACAACTCTACCAGG - Intronic
1008917319 6:56802492-56802514 CAAACTATGAACATCCTAGTAGG + Intronic
1010118762 6:72347799-72347821 CCAAATATCAACTTCCTACCAGG + Intronic
1010629315 6:78178472-78178494 CAAAATATAAAAACCCTACAAGG + Intergenic
1011582734 6:88888168-88888190 TAAAATATGAAACTCCTAAGAGG + Intronic
1012189571 6:96262685-96262707 CAAGTTATGAAACTACTACCAGG + Intergenic
1012549288 6:100453050-100453072 CAAAATCTAAAAATGCCACCGGG + Intronic
1012807346 6:103911130-103911152 CAAAATAACAAACTACTACCTGG + Intergenic
1013497571 6:110713556-110713578 CAAAAAATGAAAATATTAGCTGG - Intronic
1013823813 6:114186739-114186761 CTAACTATGAAAATCCTAGATGG - Intronic
1014186466 6:118439901-118439923 CAAACTATGAAAACACTACAAGG - Intergenic
1014914467 6:127129315-127129337 CAAGATTTGAAAATCCTTCATGG - Intronic
1015144888 6:129974695-129974717 CTAACTATGAAAGTCCTACAAGG - Intergenic
1016060707 6:139626978-139627000 CAAAGCAAGAAAATCCTAACTGG + Intergenic
1017057194 6:150448231-150448253 CAAAATTTTAACATCTTACCAGG + Intergenic
1017550729 6:155504219-155504241 AAAAAAATGAAATTCCTTCCAGG + Intergenic
1018752239 6:166817229-166817251 CTAAATTTGAAAATGTTACCAGG + Intronic
1019697887 7:2457752-2457774 CTAAATATGGCAACCCTACCTGG + Intergenic
1020031079 7:4933198-4933220 CAAAATATTAAAAAATTACCTGG + Intronic
1020341729 7:7118302-7118324 CAAAAAATAAAAATATTACCTGG + Intergenic
1020698656 7:11448905-11448927 AAAAATATGAAAATCCTGGTAGG + Intronic
1021707783 7:23384903-23384925 CAAAACAAAAATATCCTACCTGG + Intronic
1023239327 7:38126943-38126965 AAAAATATTAAAAACTTACCTGG - Intergenic
1023724506 7:43128230-43128252 CTAGCTATGAAAATCCTACATGG - Intronic
1024206421 7:47165818-47165840 GAAAATAAGAAAATCCAGCCAGG + Intergenic
1024217496 7:47259736-47259758 CAAAATAGGAAACATCTACCTGG - Intergenic
1024272844 7:47655517-47655539 CAAAATTTGAAAAAGCTCCCAGG + Intronic
1025116519 7:56263120-56263142 CAAAAAATAAAAATACTAGCTGG + Intergenic
1025159939 7:56648053-56648075 CAGAATAAGAAAACCATACCTGG + Intergenic
1028984619 7:96999757-96999779 CAAAATTTGTAAAACCTGCCAGG + Intergenic
1029709561 7:102292226-102292248 CAAAATATCAAAAAATTACCTGG + Intronic
1029815665 7:103092029-103092051 CAAAATATGAAATTTCTATCTGG - Intronic
1032009259 7:128331780-128331802 CCAACTATGTAAATCCTTCCAGG + Intronic
1032699154 7:134363626-134363648 AAAAACATGAAAATCCTGCGGGG + Intergenic
1033069325 7:138187823-138187845 AAAAATATGAAAATATTAGCTGG - Intergenic
1033525073 7:142203877-142203899 CAAACTATAAAAATCCTAGAAGG + Intronic
1034183324 7:149155445-149155467 CAAAATTTTAAAAGCCTACCAGG - Intronic
1037485740 8:19344920-19344942 GAAAATATGTAACTCCTATCAGG - Intronic
1039358419 8:36846880-36846902 CAAAATATGAATTTTCTATCAGG + Intronic
1039377333 8:37048886-37048908 CAACAAACGAAAATCATACCTGG - Intergenic
1040812009 8:51464200-51464222 CAAAAAATGAAAATATTAGCTGG + Intronic
1041365900 8:57104434-57104456 CAAACTATGAAACTACTACAAGG + Intergenic
1041454688 8:58045710-58045732 CATAAGATGAAAATCCTCCTTGG - Intronic
1041805333 8:61843166-61843188 CAAAATATCAAATTCCAACCTGG + Intergenic
1042640622 8:70930012-70930034 TAAAATACGAAAATCAAACCTGG - Intergenic
1043240266 8:77924726-77924748 CAAAATATGCAAATCAGGCCAGG + Intergenic
1043773979 8:84241614-84241636 AAAAATATGAAAAAACTAGCCGG + Intronic
1043789354 8:84444165-84444187 CAAAATATAAAAATGTTAGCCGG + Intronic
1044609335 8:94076988-94077010 CATAATTTTAAAATCCTATCCGG + Intergenic
1044741182 8:95327992-95328014 CAACATAGGGAAATCCTGCCTGG - Intergenic
1045603307 8:103744338-103744360 TTAAATATAAAAATCCTAGCTGG - Intronic
1045711545 8:104990381-104990403 AAAAATATAAACATGCTACCTGG - Intronic
1046170774 8:110502291-110502313 CAAAATATGAAAAAATTAGCCGG + Intergenic
1046446492 8:114327671-114327693 CAATATATGAAAATCCAACGTGG - Intergenic
1048390144 8:133955307-133955329 CAAAACATGAATATTCTACTTGG + Intergenic
1049096792 8:140553222-140553244 CAAAACATTAAAAACCTAGCTGG + Intronic
1049552291 8:143266102-143266124 AAAAATATAAAAAAGCTACCCGG - Intronic
1049891151 9:72527-72549 CAAAATATTAAAAACCTTCAGGG + Intergenic
1050955096 9:11646350-11646372 TAAAATCTTAAAATCCTACATGG - Intergenic
1052310112 9:27057983-27058005 CAAAGGATGAAAATACTACAAGG - Intronic
1053732590 9:41073583-41073605 CAAAATATTAAAAACCTTCAGGG + Intergenic
1057241155 9:93410708-93410730 CAAACTATGAAACTACTACACGG - Intergenic
1058105431 9:100964757-100964779 TAAAATATGAAAAACCTATTAGG - Intergenic
1058221336 9:102307510-102307532 AAAAAAATTAAAATCATACCAGG - Intergenic
1058648945 9:107157092-107157114 CAAAATATACATATCCAACCTGG + Intergenic
1059171727 9:112131039-112131061 CAAAAAAAGAAAATCCTTCAAGG + Intronic
1060365675 9:123010577-123010599 CAAACTATTAAAATCGTATCAGG + Intronic
1060466760 9:123913608-123913630 TAAAATATCAAAATCCGACCGGG + Intronic
1062417081 9:136456869-136456891 CAAAATAAGAATATCCTGGCCGG + Intronic
1185765366 X:2721455-2721477 CAAAAAATGAAAAAACTAACTGG - Intronic
1185999341 X:4990345-4990367 AAAAATAAAAAATTCCTACCGGG + Intergenic
1186033128 X:5391494-5391516 GGAAATATGTAACTCCTACCTGG - Intergenic
1186849169 X:13563212-13563234 CTAACTATGAAAATCCTAGATGG + Intergenic
1188027679 X:25227555-25227577 CAAAATATGAAACTCCTACAAGG + Intergenic
1188890625 X:35607153-35607175 CAAAAAATGCAAAACTTACCTGG + Intergenic
1188924064 X:36017495-36017517 CAAACTATGAAACTTCTACAAGG - Intergenic
1189197371 X:39163356-39163378 CACAATCTGAACATCCTACATGG - Intergenic
1189891048 X:45603017-45603039 AAAAATATGAAAAGACTACCAGG + Intergenic
1189972228 X:46429604-46429626 CAAAATATGAAAATGCAAAAAGG + Intergenic
1190477359 X:50841266-50841288 TAAAATATTAAAATCCTTCCAGG - Intergenic
1191130871 X:57008847-57008869 CAAACTATGAGATTCCTACAAGG - Intergenic
1192469994 X:71390169-71390191 GAAGAAATGAAAATCCTGCCAGG - Intronic
1193444443 X:81582937-81582959 TAAAATATGAAAATCCTAGAAGG + Intergenic
1193963480 X:87953835-87953857 CAAAATATGAAATTCTTGGCTGG - Intergenic
1194083201 X:89493520-89493542 CAAACTATGAAACTCCTGCAAGG - Intergenic
1194546763 X:95245176-95245198 CAAAATATGAAACTACTACAAGG + Intergenic
1195116965 X:101708719-101708741 CAAAATATGAAAATACTACAGGG - Intergenic
1195974022 X:110505579-110505601 CTAAATATAAAAATTCTAGCAGG + Intergenic
1198607806 X:138362272-138362294 CAATACATGAAAAACCTACATGG + Intergenic
1198666261 X:139026592-139026614 CAAAGTATGCAAATCATGCCGGG + Intronic
1198730898 X:139727252-139727274 CAAAATATCAAAAGCTTTCCTGG + Exonic
1198809493 X:140521076-140521098 CACACTATGTAAATTCTACCAGG - Intergenic
1199835852 X:151590037-151590059 CAAAACATGAAAAATCTACTGGG + Intronic
1200435852 Y:3149394-3149416 CAAACTATGAAACTCCTGCAAGG - Intergenic
1201068772 Y:10125432-10125454 AAATATATGCAAATCCTGCCTGG - Intergenic
1201241176 Y:11957924-11957946 CAATATATTAAAATTCTACCTGG - Intergenic