ID: 974963819

View in Genome Browser
Species Human (GRCh38)
Location 4:68735957-68735979
Sequence TCTGTTCTCTCTTCACGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974963819_974963828 24 Left 974963819 4:68735957-68735979 CCTATCCGTGAAGAGAGAACAGA No data
Right 974963828 4:68736004-68736026 CCTTTTAAAGAAGTCCCAGGGGG No data
974963819_974963824 21 Left 974963819 4:68735957-68735979 CCTATCCGTGAAGAGAGAACAGA No data
Right 974963824 4:68736001-68736023 GCACCTTTTAAAGAAGTCCCAGG No data
974963819_974963826 23 Left 974963819 4:68735957-68735979 CCTATCCGTGAAGAGAGAACAGA No data
Right 974963826 4:68736003-68736025 ACCTTTTAAAGAAGTCCCAGGGG No data
974963819_974963825 22 Left 974963819 4:68735957-68735979 CCTATCCGTGAAGAGAGAACAGA No data
Right 974963825 4:68736002-68736024 CACCTTTTAAAGAAGTCCCAGGG No data
974963819_974963823 -1 Left 974963819 4:68735957-68735979 CCTATCCGTGAAGAGAGAACAGA No data
Right 974963823 4:68735979-68736001 AGGAGAAGAAAGGAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974963819 Original CRISPR TCTGTTCTCTCTTCACGGAT AGG (reversed) Intergenic
No off target data available for this crispr