ID: 974963821

View in Genome Browser
Species Human (GRCh38)
Location 4:68735962-68735984
Sequence TCTCCTCTGTTCTCTCTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974963821_974963823 -6 Left 974963821 4:68735962-68735984 CCGTGAAGAGAGAACAGAGGAGA No data
Right 974963823 4:68735979-68736001 AGGAGAAGAAAGGAAAAAGAAGG No data
974963821_974963824 16 Left 974963821 4:68735962-68735984 CCGTGAAGAGAGAACAGAGGAGA No data
Right 974963824 4:68736001-68736023 GCACCTTTTAAAGAAGTCCCAGG No data
974963821_974963825 17 Left 974963821 4:68735962-68735984 CCGTGAAGAGAGAACAGAGGAGA No data
Right 974963825 4:68736002-68736024 CACCTTTTAAAGAAGTCCCAGGG No data
974963821_974963826 18 Left 974963821 4:68735962-68735984 CCGTGAAGAGAGAACAGAGGAGA No data
Right 974963826 4:68736003-68736025 ACCTTTTAAAGAAGTCCCAGGGG No data
974963821_974963828 19 Left 974963821 4:68735962-68735984 CCGTGAAGAGAGAACAGAGGAGA No data
Right 974963828 4:68736004-68736026 CCTTTTAAAGAAGTCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974963821 Original CRISPR TCTCCTCTGTTCTCTCTTCA CGG (reversed) Intergenic
No off target data available for this crispr