ID: 974963825

View in Genome Browser
Species Human (GRCh38)
Location 4:68736002-68736024
Sequence CACCTTTTAAAGAAGTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974963821_974963825 17 Left 974963821 4:68735962-68735984 CCGTGAAGAGAGAACAGAGGAGA No data
Right 974963825 4:68736002-68736024 CACCTTTTAAAGAAGTCCCAGGG No data
974963819_974963825 22 Left 974963819 4:68735957-68735979 CCTATCCGTGAAGAGAGAACAGA No data
Right 974963825 4:68736002-68736024 CACCTTTTAAAGAAGTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974963825 Original CRISPR CACCTTTTAAAGAAGTCCCA GGG Intergenic
No off target data available for this crispr