ID: 974963839

View in Genome Browser
Species Human (GRCh38)
Location 4:68736072-68736094
Sequence TCACCTAGGAAGAGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974963830_974963839 30 Left 974963830 4:68736019-68736041 CCAGGGGGTCATGATGCATTCAA No data
Right 974963839 4:68736072-68736094 TCACCTAGGAAGAGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974963839 Original CRISPR TCACCTAGGAAGAGGGTGGC AGG Intergenic
No off target data available for this crispr