ID: 974966087

View in Genome Browser
Species Human (GRCh38)
Location 4:68761912-68761934
Sequence TAGCCACAGCTGGGACACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974966074_974966087 17 Left 974966074 4:68761872-68761894 CCCACTGAAACCATGGCTTGAGG No data
Right 974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG No data
974966077_974966087 7 Left 974966077 4:68761882-68761904 CCATGGCTTGAGGTCTACCTTGG No data
Right 974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG No data
974966076_974966087 16 Left 974966076 4:68761873-68761895 CCACTGAAACCATGGCTTGAGGT No data
Right 974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG No data
974966079_974966087 -10 Left 974966079 4:68761899-68761921 CCTTGGCCCCTTTTAGCCACAGC 0: 124
1: 268
2: 634
3: 833
4: 891
Right 974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG No data
974966073_974966087 18 Left 974966073 4:68761871-68761893 CCCCACTGAAACCATGGCTTGAG No data
Right 974966087 4:68761912-68761934 TAGCCACAGCTGGGACACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974966087 Original CRISPR TAGCCACAGCTGGGACACAG GGG Intergenic
No off target data available for this crispr