ID: 974969575

View in Genome Browser
Species Human (GRCh38)
Location 4:68807485-68807507
Sequence TAGCCACAGCTGAGACAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974969575_974969583 17 Left 974969575 4:68807485-68807507 CCCCTTTGTCTCAGCTGTGGCTA No data
Right 974969583 4:68807525-68807547 GCTCAAGCCATGGCTTCAGTGGG No data
974969575_974969581 7 Left 974969575 4:68807485-68807507 CCCCTTTGTCTCAGCTGTGGCTA No data
Right 974969581 4:68807515-68807537 CCAAGGTAGAGCTCAAGCCATGG No data
974969575_974969582 16 Left 974969575 4:68807485-68807507 CCCCTTTGTCTCAGCTGTGGCTA No data
Right 974969582 4:68807524-68807546 AGCTCAAGCCATGGCTTCAGTGG No data
974969575_974969579 -10 Left 974969575 4:68807485-68807507 CCCCTTTGTCTCAGCTGTGGCTA No data
Right 974969579 4:68807498-68807520 GCTGTGGCTAAAAGGAGCCAAGG No data
974969575_974969584 18 Left 974969575 4:68807485-68807507 CCCCTTTGTCTCAGCTGTGGCTA No data
Right 974969584 4:68807526-68807548 CTCAAGCCATGGCTTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974969575 Original CRISPR TAGCCACAGCTGAGACAAAG GGG (reversed) Intergenic
No off target data available for this crispr