ID: 974981890

View in Genome Browser
Species Human (GRCh38)
Location 4:68967164-68967186
Sequence AACCTCCACCTACTTTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974981890_974981896 29 Left 974981890 4:68967164-68967186 CCTCTGAAAAGTAGGTGGAGGTT No data
Right 974981896 4:68967216-68967238 CTCCCAGGCCCAACAGCACGTGG No data
974981890_974981893 5 Left 974981890 4:68967164-68967186 CCTCTGAAAAGTAGGTGGAGGTT No data
Right 974981893 4:68967192-68967214 ACCTCAGTTCATGACTTCTGTGG No data
974981890_974981895 14 Left 974981890 4:68967164-68967186 CCTCTGAAAAGTAGGTGGAGGTT No data
Right 974981895 4:68967201-68967223 CATGACTTCTGTGGACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974981890 Original CRISPR AACCTCCACCTACTTTTCAG AGG (reversed) Intergenic
No off target data available for this crispr