ID: 974981893

View in Genome Browser
Species Human (GRCh38)
Location 4:68967192-68967214
Sequence ACCTCAGTTCATGACTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974981890_974981893 5 Left 974981890 4:68967164-68967186 CCTCTGAAAAGTAGGTGGAGGTT No data
Right 974981893 4:68967192-68967214 ACCTCAGTTCATGACTTCTGTGG No data
974981886_974981893 13 Left 974981886 4:68967156-68967178 CCGTACATCCTCTGAAAAGTAGG No data
Right 974981893 4:68967192-68967214 ACCTCAGTTCATGACTTCTGTGG No data
974981885_974981893 23 Left 974981885 4:68967146-68967168 CCAGGCATTTCCGTACATCCTCT 0: 26
1: 727
2: 1414
3: 1643
4: 1462
Right 974981893 4:68967192-68967214 ACCTCAGTTCATGACTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974981893 Original CRISPR ACCTCAGTTCATGACTTCTG TGG Intergenic
No off target data available for this crispr