ID: 974981895

View in Genome Browser
Species Human (GRCh38)
Location 4:68967201-68967223
Sequence CATGACTTCTGTGGACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974981891_974981895 -9 Left 974981891 4:68967187-68967209 CCCACACCTCAGTTCATGACTTC No data
Right 974981895 4:68967201-68967223 CATGACTTCTGTGGACTCCCAGG No data
974981892_974981895 -10 Left 974981892 4:68967188-68967210 CCACACCTCAGTTCATGACTTCT No data
Right 974981895 4:68967201-68967223 CATGACTTCTGTGGACTCCCAGG No data
974981886_974981895 22 Left 974981886 4:68967156-68967178 CCGTACATCCTCTGAAAAGTAGG No data
Right 974981895 4:68967201-68967223 CATGACTTCTGTGGACTCCCAGG No data
974981890_974981895 14 Left 974981890 4:68967164-68967186 CCTCTGAAAAGTAGGTGGAGGTT No data
Right 974981895 4:68967201-68967223 CATGACTTCTGTGGACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974981895 Original CRISPR CATGACTTCTGTGGACTCCC AGG Intergenic
No off target data available for this crispr