ID: 974981896

View in Genome Browser
Species Human (GRCh38)
Location 4:68967216-68967238
Sequence CTCCCAGGCCCAACAGCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974981892_974981896 5 Left 974981892 4:68967188-68967210 CCACACCTCAGTTCATGACTTCT No data
Right 974981896 4:68967216-68967238 CTCCCAGGCCCAACAGCACGTGG No data
974981891_974981896 6 Left 974981891 4:68967187-68967209 CCCACACCTCAGTTCATGACTTC No data
Right 974981896 4:68967216-68967238 CTCCCAGGCCCAACAGCACGTGG No data
974981890_974981896 29 Left 974981890 4:68967164-68967186 CCTCTGAAAAGTAGGTGGAGGTT No data
Right 974981896 4:68967216-68967238 CTCCCAGGCCCAACAGCACGTGG No data
974981894_974981896 0 Left 974981894 4:68967193-68967215 CCTCAGTTCATGACTTCTGTGGA No data
Right 974981896 4:68967216-68967238 CTCCCAGGCCCAACAGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974981896 Original CRISPR CTCCCAGGCCCAACAGCACG TGG Intergenic
No off target data available for this crispr