ID: 974981996

View in Genome Browser
Species Human (GRCh38)
Location 4:68968190-68968212
Sequence CATGGGAGGAAGACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974981989_974981996 24 Left 974981989 4:68968143-68968165 CCACCTAAATCTTATCTTGAATT 0: 14
1: 740
2: 8939
3: 11843
4: 10018
Right 974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG No data
974981988_974981996 25 Left 974981988 4:68968142-68968164 CCCACCTAAATCTTATCTTGAAT 0: 14
1: 685
2: 8890
3: 11844
4: 10274
Right 974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG No data
974981987_974981996 26 Left 974981987 4:68968141-68968163 CCCCACCTAAATCTTATCTTGAA 0: 14
1: 672
2: 8873
3: 11866
4: 9767
Right 974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG No data
974981990_974981996 21 Left 974981990 4:68968146-68968168 CCTAAATCTTATCTTGAATTGTA 0: 333
1: 7399
2: 10763
3: 9446
4: 7788
Right 974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974981996 Original CRISPR CATGGGAGGAAGACAGTGGA AGG Intergenic
No off target data available for this crispr