ID: 974985511

View in Genome Browser
Species Human (GRCh38)
Location 4:69020371-69020393
Sequence AAGAATTATCACATTGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 3, 2: 1, 3: 10, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974985511 Original CRISPR AAGAATTATCACATTGCACC AGG (reversed) Intronic
904107542 1:28098498-28098520 ATGAATTAGCACATAGCCCCTGG - Intergenic
904112984 1:28141264-28141286 AAGAATTGTCAAATTGCTTCTGG - Intergenic
905144514 1:35877327-35877349 GAGAAATAGCACATTACACCAGG - Intronic
906967030 1:50467911-50467933 TCAAAATATCACATTGCACCAGG + Intronic
909625663 1:77713094-77713116 AAGAATAAACACATAGCACAAGG + Intronic
915819458 1:159006365-159006387 AAGATTTACAACCTTGCACCTGG - Intronic
917891938 1:179448060-179448082 CAGAATCATAACATTGCACCTGG - Intronic
923148184 1:231212231-231212253 AAGATTTAGAACCTTGCACCTGG - Intronic
1063507193 10:6610689-6610711 TAGGATTATCACATTTCACCTGG - Intergenic
1065049078 10:21772091-21772113 AAGAATTATCACCATGAAGCTGG - Intronic
1070650434 10:78231507-78231529 AAGCATTATGAAATTGCTCCTGG - Intergenic
1073912140 10:108358447-108358469 AAGAATTTTCACAATGAACCTGG - Intergenic
1075415927 10:122264351-122264373 AAGAATAACCACATTGAAACAGG - Intergenic
1075610250 10:123848286-123848308 AAGGATCAGCAGATTGCACCTGG - Intronic
1082672806 11:56056365-56056387 AAGATTTAGAACCTTGCACCTGG - Intergenic
1085823637 11:79819702-79819724 ATAAATTATCACAATGAACCAGG + Intergenic
1087398765 11:97637148-97637170 AAGATTTAGAACCTTGCACCTGG + Intergenic
1088153123 11:106771845-106771867 AAGAAATATCATATTGATCCAGG + Intronic
1088767199 11:112994269-112994291 AAGAATTTCCACATTGTAACTGG + Intronic
1091419963 12:328363-328385 AAGCATCATCACATTGAACTGGG - Intronic
1092752744 12:11734035-11734057 ATGGATTATCTGATTGCACCAGG + Intronic
1092796546 12:12115522-12115544 AAGAATCATCACATCACACTGGG + Intronic
1094031713 12:26019678-26019700 AAGATTTATCACTTTGCAGAAGG + Intronic
1096430006 12:51535025-51535047 AAGAAACATCATAGTGCACCGGG + Intergenic
1098416961 12:70244409-70244431 AAGAGTTATCAGCTTTCACCCGG - Intronic
1099021580 12:77411990-77412012 AAGAATAATCACATTGTAGCTGG + Intergenic
1104499021 12:129266847-129266869 AAGAATCATCACATCTCACCTGG + Intronic
1107198939 13:37690235-37690257 AATAATTTTCACATTGCAGTTGG - Intronic
1110931597 13:81225122-81225144 AGGTATTTTCACATTGCAACTGG + Intergenic
1113951194 13:114071887-114071909 AAGAATTATATCCTTGCATCTGG - Intronic
1114971298 14:28032599-28032621 ATGAATTATAAGATTGCATCAGG + Intergenic
1118428195 14:65690816-65690838 CAGGATTATCAGCTTGCACCCGG - Intronic
1122200370 14:100118925-100118947 AAGAATCATCACAGTCCAGCGGG + Intronic
1123152583 14:106197265-106197287 AAGATTTAGAACCTTGCACCTGG - Intergenic
1124271383 15:28283834-28283856 AACACTTATCAGATTGTACCTGG - Intronic
1140279581 16:73542462-73542484 AAGAGTCATCTCATTCCACCTGG - Intergenic
1150914217 17:69420270-69420292 AATAATTCTTACATAGCACCTGG + Intronic
1153377298 18:4395153-4395175 AAGAAATAGCACATTGCATTGGG + Intronic
1154426037 18:14272723-14272745 ATGAATCATCTCATTGCCCCTGG + Intergenic
1154433720 18:14327961-14327983 ATGAATCATCTCATTGCCCCTGG + Intergenic
1154937332 18:21074550-21074572 AAGAATGTTCACATTCCAGCGGG - Intronic
1156304949 18:35869252-35869274 ATGAAATACCACTTTGCACCTGG - Intergenic
1158386920 18:57004636-57004658 AAAAATTACCACATTGCATACGG + Intronic
1161611631 19:5246377-5246399 AAGCATTATCTCATAGCAACAGG + Intronic
1164841068 19:31392784-31392806 GAGCATTTTCACATTGCAACAGG - Intergenic
926489813 2:13511428-13511450 AAGAATTAGCAAATTTCAACAGG + Intergenic
928234304 2:29526762-29526784 AAGACTTGCCACATTGCACTGGG + Intronic
932003251 2:67904080-67904102 AAGAATTGTCACATGGCAGATGG + Intergenic
933280640 2:80329391-80329413 GAGAATGATCCCATTGCACCAGG + Intronic
934843817 2:97648620-97648642 ATGAATTCTTACTTTGCACCTGG - Intergenic
940340281 2:152573009-152573031 AAGAATTATGACATTTCTCAGGG + Intronic
941580392 2:167290492-167290514 ATGAATTCTCTCATTGCACAAGG + Intergenic
942053134 2:172159062-172159084 AACAATTATTACTGTGCACCAGG + Intergenic
945401618 2:209389293-209389315 AAGAAATATCAAATAGCCCCAGG + Intergenic
946116404 2:217466356-217466378 CAGAATTATCACATCGGTCCTGG + Intronic
947393472 2:229664025-229664047 AGAAATTATCATATTGGACCAGG - Intronic
1169415761 20:5414988-5415010 AAGAATTCTGACATTGAACCTGG - Intergenic
1176843311 21:13857783-13857805 ATGAATCATCTCATTGCCCCTGG - Intergenic
1176848729 21:13896660-13896682 ATGAATTATGTCATTGCCCCTGG - Intergenic
950652500 3:14416010-14416032 AAGAACCATCACATTGCCCTTGG - Intronic
951116220 3:18865358-18865380 AAGTATTATAAAATTGCACAAGG - Intergenic
951856923 3:27207657-27207679 CAGAATTAACACATTGCAGTGGG - Intronic
953004091 3:38961268-38961290 AAGAATTATCATATTTAACATGG - Intergenic
953448729 3:42989151-42989173 AAGAGTTATCACATTATCCCTGG - Intronic
953468542 3:43146750-43146772 AAGAGTGATCTCATTGCAACAGG + Intergenic
957023174 3:75147454-75147476 AAGAATGATAACATTCCCCCAGG + Intergenic
959258060 3:104039919-104039941 AACAAATCTCACATTCCACCAGG + Intergenic
959760691 3:109960236-109960258 AAGAATTAACATATAGCAGCAGG - Intergenic
960293498 3:115914955-115914977 AAGAATAATCACATTGAAAGAGG + Intronic
961203224 3:125060819-125060841 AAGAATTATCACTTCCCACCTGG - Intergenic
969474650 4:7414727-7414749 AAGATTTAGAACCTTGCACCTGG - Intronic
970785114 4:19786064-19786086 AAGAAATTTCACATTTCAGCTGG - Intergenic
974010834 4:56605870-56605892 AAGATTTAGAACCTTGCACCTGG + Intergenic
974875362 4:67697756-67697778 AACCATCATCACATTTCACCTGG + Intronic
974945152 4:68517645-68517667 AAGAAACATTGCATTGCACCAGG - Intergenic
974955058 4:68628915-68628937 AAGAAGCATTGCATTGCACCAGG - Intronic
974970279 4:68815997-68816019 AAGAATTATCACATTGCACAAGG + Exonic
974985511 4:69020371-69020393 AAGAATTATCACATTGCACCAGG - Intronic
975000144 4:69214723-69214745 AAGAATGATCGCATTGCACCAGG - Exonic
975005622 4:69280478-69280500 AAGAATGATTGCATTGCACCAGG + Exonic
975014034 4:69389469-69389491 AAGAATGATCACATTGCACCAGG + Intronic
975015289 4:69408814-69408836 AAGAATGATCACATTGCACCAGG + Intronic
975161207 4:71126451-71126473 TAGAATTACCAGATTTCACCAGG + Intergenic
975236863 4:72008904-72008926 AAGGATTATCACATAGAAACAGG + Intergenic
976731113 4:88262908-88262930 AAGGATTATTAAATTGCACACGG + Intronic
979217622 4:118184139-118184161 AAGAATCATTTCATTGCACATGG + Intronic
981410536 4:144425166-144425188 AGGCATTCTCACATAGCACCTGG - Intergenic
984506905 4:180631217-180631239 AATGATTAGCAGATTGCACCTGG + Intergenic
984686970 4:182679986-182680008 AATAATTCTCACATTTTACCTGG - Intronic
987214475 5:15719097-15719119 AAGAATTCACACATTTCTCCAGG + Intronic
987787118 5:22515039-22515061 AATAATTATCTCCTTGCAACAGG + Intronic
988371652 5:30377135-30377157 AGGGATTATCACATTTCACGGGG - Intergenic
989094656 5:37770603-37770625 ATGAATTATCTCATTTAACCTGG - Intergenic
989341105 5:40376596-40376618 AAGAATTATTATTTTTCACCAGG - Intergenic
992548326 5:77837304-77837326 TAGAATTATGACAATGGACCAGG - Intronic
993339657 5:86707789-86707811 AAGAATTATCACATTTTATTTGG + Intergenic
993842544 5:92898437-92898459 AAGAAGTATAATATTGGACCTGG + Intergenic
994314303 5:98314389-98314411 AAGATTTATCACAATGAATCTGG + Intergenic
995885132 5:116885941-116885963 TAGAATTTGCACATTACACCAGG - Intergenic
997257684 5:132441834-132441856 AAGAATGAGCAAATTGCACCAGG + Intronic
1001205382 5:169757307-169757329 AAGCATTATGACATTCCTCCAGG - Intronic
1002887066 6:1307149-1307171 AAGAAATATCTCATTCCTCCAGG + Intergenic
1003827107 6:9965094-9965116 AATATTTATCTCTTTGCACCAGG + Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1004952812 6:20693367-20693389 AAGAATTATCTTATTTCAACTGG - Intronic
1006759476 6:36446677-36446699 AAGAAATATCACATTGGATGAGG - Intronic
1009773989 6:68181005-68181027 AAGATTTAGAACCTTGCACCTGG - Intergenic
1010932827 6:81822979-81823001 ATGATTTATCACTTTGCAACAGG + Intergenic
1011184861 6:84662882-84662904 AAGAATTCTCAATTTGAACCTGG + Intergenic
1012422212 6:99077936-99077958 CAGAATTTTCACTTTTCACCTGG + Intergenic
1013097569 6:106959737-106959759 AACAGTGATCACATTTCACCTGG + Intergenic
1014575564 6:123066482-123066504 AAGAATTATCGCATTTGACTTGG + Exonic
1015345634 6:132154699-132154721 CAGAATAATCACCTTGCCCCCGG - Intergenic
1019102475 6:169642484-169642506 CAGAATCTTCACAGTGCACCTGG - Intronic
1019868215 7:3733161-3733183 AAGACTTAAGACATTGCACAGGG - Intronic
1021033822 7:15772101-15772123 ATGAGTTATCACCTTACACCTGG + Intergenic
1022237555 7:28476733-28476755 AAGAATTAAAAGATTGCTCCAGG + Intronic
1024357362 7:48427796-48427818 AAGAAATCTCACATTGCCCTGGG + Exonic
1025785954 7:64643434-64643456 AAGTATTGTGACATTTCACCAGG + Intergenic
1026124313 7:67566147-67566169 AAGAGTTAACACATTCCACTTGG + Intergenic
1026349132 7:69500385-69500407 AAGAAGTAACAAATTGCACAAGG + Intergenic
1026406491 7:70071414-70071436 AAGAACTATTACATTTCCCCAGG - Intronic
1032694999 7:134327958-134327980 AAGAATCAGCACATTGCAATAGG - Intergenic
1034714353 7:153226038-153226060 GAGAATTAACACATTTCAGCTGG + Intergenic
1037223341 8:16553062-16553084 AAAAATTATCACATTTTCCCTGG + Intronic
1041499255 8:58522092-58522114 AACAATTATTACATTGTACTGGG + Intergenic
1041554674 8:59139905-59139927 AATAATTATGACAGTGCAACAGG + Intergenic
1044807691 8:96024752-96024774 AACAAAAATCACATTGAACCTGG + Intergenic
1045821490 8:106343582-106343604 CATAATTATCTCATTGCAACTGG + Intronic
1050008096 9:1156117-1156139 AAGATTTATCATGTTGCAACTGG - Intergenic
1051072209 9:13184462-13184484 AAGAATTATAACATTATATCAGG + Intronic
1051426978 9:16942034-16942056 AAGAATAATCACAATGGGCCAGG + Intergenic
1053505445 9:38639057-38639079 AAGAATTATCAGACTGCCCATGG - Intergenic
1060167904 9:121434794-121434816 AACAATTATGCCATTCCACCAGG + Intergenic
1060387177 9:123241730-123241752 TAGAATAATCACCTTTCACCTGG + Intronic
1062544427 9:137055149-137055171 AAGAATTCCCACTTTGCAGCAGG - Intergenic
1187635592 X:21224537-21224559 AAGAATTGTCACATGGAAGCTGG + Intergenic
1188610170 X:32085875-32085897 AAGAATTTACACATTTCACATGG - Intronic
1193334350 X:80270858-80270880 AAGAATGAACACATTTAACCAGG + Intergenic
1196944936 X:120814380-120814402 AAGATTTAAAACCTTGCACCTGG + Intergenic
1197721737 X:129749921-129749943 AAGAATTAGAACAATGCACATGG + Intronic
1197868754 X:131045923-131045945 ATGAATTCTCCCACTGCACCTGG - Intergenic
1198535210 X:137578764-137578786 AGGTATTATCACAGTGCAGCTGG - Intergenic
1198768121 X:140099067-140099089 AAGAATGAACAAATTGCAGCTGG - Intergenic
1200845788 Y:7831271-7831293 AAGATTTAGAACCTTGCACCTGG + Intergenic