ID: 974989277

View in Genome Browser
Species Human (GRCh38)
Location 4:69064290-69064312
Sequence TCCCTATGTTGAAGGAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974989277_974989279 8 Left 974989277 4:69064290-69064312 CCAAAACTCCTTCAACATAGGGA 0: 1
1: 0
2: 2
3: 36
4: 206
Right 974989279 4:69064321-69064343 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974989277 Original CRISPR TCCCTATGTTGAAGGAGTTT TGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
908433767 1:64084742-64084764 TTTGTCTGTTGAAGGAGTTTGGG - Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913551867 1:119924200-119924222 TCACTATGCTGCAGGAGCTTAGG + Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915791210 1:158673437-158673459 GCCCTATGATGTAGGAGGTTAGG + Intronic
916202182 1:162282762-162282784 TACCTATCTAGAAGGAGCTTTGG - Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916858108 1:168772830-168772852 TACATAATTTGAAGGAGTTTGGG - Intergenic
920445262 1:206011495-206011517 TCCCTATGTGGCAGGAGCTTAGG + Intronic
921059763 1:211575810-211575832 TCGAAATGTTGAAGGAGTTGAGG - Exonic
921234053 1:213106505-213106527 TCCTTAATTTGAAGGAGTCTCGG + Intronic
1063609013 10:7547488-7547510 TACTCATCTTGAAGGAGTTTTGG + Intergenic
1065015757 10:21461402-21461424 TACATATATTGAAGGAGTTACGG + Intergenic
1068244689 10:54349251-54349273 TCCCTAAGTTGTAGGGCTTTGGG - Intronic
1071884846 10:89938605-89938627 TACCTATGTTGAAAGATTTAAGG - Intergenic
1075459132 10:122604426-122604448 GCCCCATGTTTAATGAGTTTTGG + Intronic
1075459764 10:122608485-122608507 GCCCCATGTTTAATGAGTTTTGG + Intronic
1075460396 10:122612544-122612566 GCCCCATGTTTAATGAGTTTTGG + Intronic
1075461028 10:122616603-122616625 GCCCCATGTTTAATGAGTTTTGG + Intronic
1078428219 11:11268294-11268316 CCCCTATTTTGAGGAAGTTTTGG - Intergenic
1080952128 11:37046139-37046161 TCCCTAATTGCAAGGAGTTTGGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083629728 11:64089337-64089359 GCCCTATTTTGACCGAGTTTGGG - Intronic
1084538406 11:69772381-69772403 TCCCTGTGTTTAGGGAGCTTTGG - Exonic
1085812597 11:79698292-79698314 TCCCCATCTTGAAGCAGTTTTGG - Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1087993604 11:104776718-104776740 TTCCTATGATGAACCAGTTTAGG + Intergenic
1088381341 11:109196556-109196578 CCTCTATGTTGAAGGAATTTGGG + Intergenic
1094638655 12:32251673-32251695 TCCCTGTGTTAATGGAGTCTTGG + Intronic
1094706878 12:32922869-32922891 TCCCTATTTTTAAGGTTTTTGGG - Intergenic
1094813601 12:34164067-34164089 ACCCTATGTAGAAGGGGATTAGG - Intergenic
1095103315 12:38204468-38204490 ACCCTATGTAGAAGGGGATTAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097620487 12:61933063-61933085 TCACTATGTAGATGTAGTTTGGG - Intronic
1098977018 12:76913342-76913364 TCCCTATCTTGAAGCTATTTAGG - Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1106662487 13:31814504-31814526 TCCATATGTGGAAGGCGTTCTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108498651 13:51048759-51048781 TGGCTATGTTGCAGGAGTTATGG + Intergenic
1108727500 13:53199389-53199411 TTCCTATATTGAAAGATTTTTGG - Intergenic
1109052515 13:57502605-57502627 TCCCTAAGTTGAAAAACTTTAGG - Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109569664 13:64171227-64171249 TGTCAATGTTGTAGGAGTTTCGG - Intergenic
1109822702 13:67679423-67679445 TGCCTTTGCTGAAGGACTTTGGG + Intergenic
1111613498 13:90635968-90635990 TCCTTCTGTTGAAGGAGTCTAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116674459 14:47887881-47887903 TCCATATGTTTAAGAAATTTGGG + Intergenic
1117163505 14:53011726-53011748 ACCCTATGTTGAAGGTCTTTAGG + Intergenic
1119146993 14:72326410-72326432 TCCCAGTGTTGGAGGTGTTTGGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1125367733 15:38936885-38936907 TTTCTATGTTGAAGCAGTTCTGG + Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1128827702 15:70735444-70735466 TTCCTATATTTAAGGGGTTTAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130911497 15:88274063-88274085 TCCCTCTGCTTAAGGATTTTAGG - Intergenic
1131931747 15:97450145-97450167 TCCCTATGAAGAAGGGGTTATGG - Intergenic
1135177591 16:20244521-20244543 TGCCTATGGGGAAGGGGTTTAGG - Intergenic
1138277000 16:55742508-55742530 TCCCTTTGTTGTAAGAGTCTAGG + Intergenic
1138917725 16:61487910-61487932 TAACTATGTTGGAGGAGTTGAGG - Intergenic
1141404596 16:83781139-83781161 TGCCTATGTGGAAGGACTTGTGG - Intronic
1142440891 16:90096891-90096913 ACCCTATGTAGAAGGGGATTAGG + Intergenic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1144546472 17:16200867-16200889 TCCCCAGGTTGGAGGATTTTGGG - Intronic
1145299904 17:21626448-21626470 TCCCCAGGTTGGAGGATTTTAGG + Intergenic
1145350378 17:22076817-22076839 TCCCCAGGTTGGAGGATTTTAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146179724 17:30689909-30689931 TCCATATGTTGGAAGAGTTGGGG + Intergenic
1146589367 17:34115289-34115311 TACCTATGTTTAAGGAGCTTTGG + Intronic
1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG + Intronic
1148494205 17:48042860-48042882 GGTCTCTGTTGAAGGAGTTTGGG - Intergenic
1149396997 17:56255167-56255189 GCCCTGTGTTGATGGTGTTTTGG + Intronic
1150666094 17:67139923-67139945 TCCCTATGTAGCAGGAGATGGGG - Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153345671 18:4023154-4023176 TCCTAATTTTGAAAGAGTTTGGG + Intronic
1153736792 18:8078930-8078952 TCCCAATGTTGGAGGTGTTTGGG - Intronic
1157738087 18:50068494-50068516 TAACTTTGTTGGAGGAGTTTTGG - Intronic
1158557853 18:58490100-58490122 ACCCTAGGTTGAATAAGTTTAGG - Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160478898 18:79220144-79220166 TCCTTATGGACAAGGAGTTTTGG + Intronic
1161277510 19:3426883-3426905 TGCTTATGCTGAAGGGGTTTAGG - Intronic
1162978886 19:14225653-14225675 TCCATATGTTGGAAGAGTTGGGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164236603 19:23342693-23342715 TCCCTTTGTAGAATGATTTTGGG - Intronic
1164288344 19:23842723-23842745 TCCCTTTGTAGAATGATTTTGGG + Intergenic
1164320594 19:24141198-24141220 TCCCTTTGTAGAATGATTTTGGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165056596 19:33180916-33180938 TCTTTATTTTGTAGGAGTTTGGG + Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925125495 2:1452847-1452869 CCCCTAAGTTGAAGGGGTGTAGG - Intronic
925700966 2:6637643-6637665 TTCATATGTTGAAGGAAGTTGGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
931117778 2:59183087-59183109 CCCCTGTGTTGTAGGAGTTGAGG - Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933437477 2:82266524-82266546 TCTGTATGTTGATGGGGTTTTGG + Intergenic
933803076 2:85978370-85978392 TGCCTCTGGTGATGGAGTTTGGG - Intergenic
937050937 2:118889009-118889031 TCCCTGTCTTCAAGGAGTTTAGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
940665613 2:156605567-156605589 TCCCCAAGATGAAGGAGATTTGG - Intronic
942719096 2:178929278-178929300 TACCTTTGGTGAAGGAATTTGGG + Intronic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
944497812 2:200326411-200326433 TCCCTAGGGTGAAGGATTATTGG - Intronic
945218848 2:207464073-207464095 TCGCTATCCTGAAGCAGTTTCGG + Intergenic
945446745 2:209947339-209947361 TCTCTATGTTGCAGGAATATTGG - Intronic
945612876 2:212028249-212028271 TTCCTCAGTTCAAGGAGTTTTGG - Intronic
947410526 2:229833694-229833716 TCCCTTTTATGAAGTAGTTTAGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1169391859 20:5197200-5197222 CCCCTCTGTTGAAGGATCTTGGG + Exonic
1169939848 20:10925313-10925335 TCCTTATGTTCAAGGAAATTAGG - Intergenic
1171560633 20:26121824-26121846 TCCCTAGGTTGGAGGATTTTAGG - Intergenic
1172774663 20:37400056-37400078 TCCCTGTGTGGTAGGAGTTGGGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174094603 20:48078311-48078333 TTCCTTTGTTAAAGGTGTTTGGG + Intergenic
1175001194 20:55632521-55632543 TCCCTGTGTTACAGGATTTTTGG + Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176650523 21:9542597-9542619 TCCCCAGGTTGGAGGATTTTAGG + Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177257120 21:18678790-18678812 TACCTTTGTGAAAGGAGTTTTGG + Intergenic
1180736592 22:18022309-18022331 TCGCCATGTGGAAGGATTTTAGG + Intronic
1182258766 22:29057714-29057736 GCCCTATGTAGAAGGAGCTAGGG + Intergenic
1183340171 22:37275743-37275765 TCCCTGTGTTGTAGGATTTACGG - Intergenic
1183531111 22:38353837-38353859 TCCCTCCCTTGCAGGAGTTTGGG + Intronic
950053764 3:10010130-10010152 TCCCTATCTTAAAAGACTTTCGG + Intronic
957034455 3:75281092-75281114 TCCCTCTGCTGAAGGAGGTGGGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
960695911 3:120396144-120396166 TTCATAGGTGGAAGGAGTTTGGG - Exonic
960702013 3:120448787-120448809 TCCCTGTGTGGAAGGGGGTTGGG + Intronic
961078366 3:124002994-124003016 TCCCTCTGCTGAAGGAGGTGGGG - Intergenic
962297740 3:134207747-134207769 TTCCTATGATCAAGAAGTTTGGG + Intronic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
964788440 3:160426485-160426507 CCACTATCTTGAAGGGGTTTTGG - Intronic
965163768 3:165169036-165169058 TCCCTCAGCTGCAGGAGTTTTGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966389142 3:179433275-179433297 CCCCTATGTTGAAAGTTTTTGGG - Intronic
967678957 3:192337215-192337237 TCCCTATGTTACAGAAGTTCAGG + Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972305283 4:37824912-37824934 TCCGTATCTTGATTGAGTTTGGG - Intergenic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
973893170 4:55387952-55387974 GCCCTGGGTTGAAGGAGTCTTGG + Intergenic
974100461 4:57410658-57410680 TGCCTATGTTAAAAGAGGTTGGG - Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975514314 4:75228886-75228908 TCCATATGTTTAAAGAGTTAAGG - Intergenic
976081665 4:81361626-81361648 TCCATAAGTTAAAGAAGTTTGGG + Intergenic
976410993 4:84713502-84713524 CCCATATGTGAAAGGAGTTTTGG + Intronic
977350410 4:95877902-95877924 TTCTTATGTTGAAGGAAATTTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
978640573 4:110866473-110866495 TCCCTAATTTTAAGGAGTTATGG - Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
981484171 4:145267729-145267751 GCCCTAATTTGGAGGAGTTTAGG + Intergenic
982340406 4:154292543-154292565 TTGCTCTGTTGAAGTAGTTTAGG - Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
988191833 5:27947407-27947429 TCCCTAAGTCTAAGGAGTTAAGG - Intergenic
990278102 5:54221045-54221067 TCCATATGGTGAAGCAATTTGGG - Intronic
991938967 5:71831764-71831786 TCTTTATGTTGAAGGAGATCAGG + Intergenic
992486675 5:77203715-77203737 TCCCTATTTCTATGGAGTTTGGG - Intergenic
995118063 5:108504307-108504329 TCTCTGTGATGTAGGAGTTTAGG + Intergenic
998870189 5:146544132-146544154 TCCCTGTGATGGAGGAGTCTGGG - Intergenic
1001442180 5:171751369-171751391 TCCCTAAGTAGAAGGTGGTTAGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003386579 6:5673142-5673164 TCCCTACCCTGAAGGAATTTGGG + Intronic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1004103177 6:12636250-12636272 TTCTTATTTTGAAGGAATTTGGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006293406 6:33158245-33158267 ACTCTAGGTTGAAGGACTTTTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007782739 6:44263705-44263727 TCCCTCTGTTGGAGGTGTCTGGG - Intronic
1011002139 6:82603163-82603185 TTTTTATGTTGAAGGAGATTTGG - Intergenic
1013844343 6:114431529-114431551 TGCTTATTTTAAAGGAGTTTTGG - Intergenic
1015145551 6:129981622-129981644 CTCCTATCTTGAATGAGTTTAGG - Intergenic
1016480696 6:144478075-144478097 TACAAATGTTGAAGTAGTTTTGG + Intronic
1018028775 6:159825952-159825974 TTCCCATGTTCAAGTAGTTTTGG - Intergenic
1021706828 7:23375921-23375943 TCCCTTTATTGAACTAGTTTAGG - Intronic
1022255194 7:28649200-28649222 GTCCTAGGTTGAAGGCGTTTTGG - Intronic
1022363019 7:29681357-29681379 TTCTTATATTGAAGGAGTGTGGG - Intergenic
1022428295 7:30289242-30289264 TTCTTATATTGAAGGAGTGTGGG + Intronic
1022698374 7:32732430-32732452 TTCTTATATTGAAGGAGTGTGGG + Intergenic
1023065289 7:36371500-36371522 TTCATAAGTTGATGGAGTTTTGG + Intronic
1025277201 7:57593562-57593584 TCCCCAGGTTGGAGGATTTTAGG + Intergenic
1030656338 7:112172378-112172400 TCCCTATGAGAAAGGAATTTGGG + Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034558608 7:151865425-151865447 TCCCTATGTTTTTGGTGTTTTGG + Intronic
1037650470 8:20833522-20833544 TCCCCAAGTTGGAGGTGTTTGGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040747468 8:50662986-50663008 TCCAGCTGATGAAGGAGTTTAGG + Intronic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043265224 8:78258112-78258134 TCTCAATGTTCAAGAAGTTTGGG - Intergenic
1043416242 8:80053428-80053450 TACCTATGAGGAAGGGGTTTGGG + Exonic
1045225832 8:100244815-100244837 TTCCTTTTTTGAAGGAATTTTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1046932398 8:119854975-119854997 TCCCTATTTTGCAGGAGCTGGGG + Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047843957 8:128785823-128785845 TCCTTAATTTGAAAGAGTTTTGG - Intergenic
1050361254 9:4833179-4833201 TCCCTTTGTTGAAACAATTTGGG + Exonic
1052577088 9:30304462-30304484 TCCCTTTATTCAAGGACTTTGGG - Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1054858331 9:69924819-69924841 CCCCAATGTTGTTGGAGTTTTGG + Intergenic
1055780316 9:79814040-79814062 TCTCTATGATGAAGGAGGTAGGG + Intergenic
1056108184 9:83368660-83368682 TCCCTATTTTCAACAAGTTTTGG + Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1061943290 9:133894338-133894360 AGCCTTTGTTGAAGGAGCTTAGG - Intronic
1062741512 9:138178040-138178062 ACCCTATGTAGAAGGGGATTAGG + Intergenic
1203628263 Un_KI270750v1:46151-46173 TCCCCAGGTTGGAGGATTTTAGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186076360 X:5883682-5883704 TCCATATGTTCTAGAAGTTTTGG + Intronic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188107581 X:26162790-26162812 ACCCTATCTTGTAGGAATTTTGG - Intergenic
1188173859 X:26963837-26963859 TCCCATTATTGAAGGAGGTTTGG - Intergenic
1188276193 X:28204321-28204343 TACCAATGTTGTAGGAATTTAGG - Intergenic
1189852993 X:45195383-45195405 ACCCTATGTTGAGGGACTTGGGG - Intronic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1196286360 X:113885402-113885424 TCCCTATGTTGAAACACTTTAGG - Intergenic
1196538636 X:116878741-116878763 TGTCTATGTAGAATGAGTTTGGG + Intergenic
1197619203 X:128728119-128728141 TCCGTGTGGTGAAGGAGGTTAGG + Intergenic
1200214286 X:154360573-154360595 TCCCTCAGGTGAAGGCGTTTGGG - Exonic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202248076 Y:22839942-22839964 TCCCTCTCTTGACAGAGTTTAGG - Intergenic
1202334090 Y:23788290-23788312 TCTCTATGTTGAAGATGCTTAGG - Intergenic
1202401064 Y:24473690-24473712 TCCCTCTCTTGACAGAGTTTAGG - Intergenic
1202469716 Y:25196396-25196418 TCCCTCTCTTGACAGAGTTTAGG + Intergenic
1202536678 Y:25881769-25881791 TCTCTATGTTGAAGATGCTTAGG + Intergenic