ID: 974990763

View in Genome Browser
Species Human (GRCh38)
Location 4:69085753-69085775
Sequence TTGGACACATACCACCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974990763_974990767 14 Left 974990763 4:69085753-69085775 CCTGGTTGGTGGTATGTGTCCAA No data
Right 974990767 4:69085790-69085812 CTTTAGATTTTTTAATTTGTTGG 0: 1
1: 2
2: 30
3: 183
4: 1287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974990763 Original CRISPR TTGGACACATACCACCAACC AGG (reversed) Intronic