ID: 974990763

View in Genome Browser
Species Human (GRCh38)
Location 4:69085753-69085775
Sequence TTGGACACATACCACCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974990763_974990767 14 Left 974990763 4:69085753-69085775 CCTGGTTGGTGGTATGTGTCCAA 0: 1
1: 0
2: 0
3: 13
4: 117
Right 974990767 4:69085790-69085812 CTTTAGATTTTTTAATTTGTTGG 0: 1
1: 2
2: 30
3: 183
4: 1287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974990763 Original CRISPR TTGGACACATACCACCAACC AGG (reversed) Intronic
900944496 1:5822206-5822228 TTGTACACAGCCCACAAACCAGG - Intergenic
901235037 1:7663156-7663178 TTGGACACGTACCCCAAGCCCGG - Intronic
906850176 1:49240380-49240402 TTGAACTCCTACCACCCACCAGG + Intronic
906862182 1:49373284-49373306 TTGGTCATATACCACATACCAGG - Intronic
910199253 1:84681738-84681760 TTAGACAAATCCCACCAATCAGG + Intronic
914933252 1:151953533-151953555 TTGGACACTCACCACCAGACTGG + Intergenic
917489714 1:175487762-175487784 TTGGAAACTTACCACGTACCAGG - Intronic
918827083 1:189337911-189337933 CTGGACACATACAACCTTCCAGG + Intergenic
922580039 1:226690270-226690292 TTGAATACATACCATCAGCCAGG + Intronic
1069010469 10:63366192-63366214 TTGATCACATACCACCCACATGG - Intronic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1072736430 10:97882492-97882514 AAGGAGACACACCACCAACCTGG - Intronic
1073229803 10:101959477-101959499 TTGCACACATCCCATCAACAAGG + Intronic
1078968150 11:16371364-16371386 TTGCACATATACCTCCACCCTGG + Intronic
1079285449 11:19126476-19126498 ATAGGCACATACCACCACCCTGG + Intronic
1083337062 11:61928751-61928773 TTGGACACATTCCTCCAAAGAGG - Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1097744250 12:63283777-63283799 TTGCACACATACCACCAGAAGGG + Intergenic
1098272730 12:68784588-68784610 TTGAACACATACTAAGAACCAGG - Intronic
1099421378 12:82465824-82465846 TTAGACACATACAACCTACCAGG - Intronic
1102041701 12:109805216-109805238 TTGGGCACCTACCACATACCAGG - Intronic
1105460900 13:20585544-20585566 TTGATCACATACCACCCACCAGG + Intronic
1107024720 13:35788227-35788249 TTGGACTACTACCAGCAACCAGG - Exonic
1108249740 13:48552057-48552079 TTGGGCTCATTCCACCCACCTGG - Intergenic
1109056087 13:57551257-57551279 TCGGACACATAGCATCAACAAGG - Intergenic
1113916919 13:113879719-113879741 TTGGAAAAGTACCACAAACCGGG + Intergenic
1113968071 13:114165927-114165949 TTGGACCCAAGCCACCAAGCTGG + Intergenic
1119704170 14:76773734-76773756 TTGGAGACAGACCAGCCACCAGG + Intronic
1122094689 14:99362466-99362488 TTGGGCACATACCATGGACCAGG - Intergenic
1122357176 14:101130808-101130830 TTGGATACTCAGCACCAACCGGG - Intergenic
1123720016 15:23051548-23051570 CTAGACACATACCACCTACCAGG - Intergenic
1125550564 15:40541472-40541494 ATGGGCACACACCACCAACCCGG + Intronic
1127327127 15:57906612-57906634 TTGGAAACAGACCACCAACAGGG - Intergenic
1131680127 15:94712637-94712659 CTGGACACTTGCCAACAACCAGG + Intergenic
1132780815 16:1624249-1624271 TTGGAGACAGACCCCCCACCGGG + Intronic
1133131494 16:3678840-3678862 TTGGACTCAGACCAACAGCCTGG - Intronic
1138141870 16:54575744-54575766 TTGGACACATATCCTCAAGCAGG + Intergenic
1143836206 17:9694962-9694984 TTGGAAACAAACCATCAAACTGG + Intronic
1150525545 17:65918645-65918667 TTGGAAACAAACAACCAACCAGG - Intronic
1160389596 18:78520142-78520164 TTGGACGCAGCCCACCATCCAGG - Intergenic
1163131396 19:15275638-15275660 TTCGACACATAAGACAAACCTGG + Intronic
1164552443 19:29222620-29222642 TTGGACACATTCCTACAAACAGG - Intergenic
1168004198 19:53472996-53473018 CTGTACACATACTACCTACCTGG - Intronic
1168680772 19:58313972-58313994 TTGGACATGTACAGCCAACCAGG + Intronic
928371215 2:30741553-30741575 TCGGCCACCTCCCACCAACCTGG - Intronic
933239941 2:79909092-79909114 TTGGGCACATAACACCCAACAGG - Intronic
935795275 2:106634910-106634932 TTGGACACAGACCACACACAGGG + Intergenic
936746046 2:115577768-115577790 TTGGACACATACCTGCAAAAAGG - Intronic
941523556 2:166579637-166579659 CTGGACACATATTACCTACCAGG - Intergenic
944089721 2:195892890-195892912 TGGGACACAAACTACCAAACTGG + Intronic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
948639934 2:239369168-239369190 TTGGACAGATGCCAACAAGCGGG + Intronic
1168982920 20:2023273-2023295 TTGAACTCATAATACCAACCTGG + Intergenic
1169093869 20:2878622-2878644 TTGGACTCTTACTCCCAACCTGG + Intronic
1177137571 21:17322380-17322402 CTAGACACATACAACCTACCAGG + Intergenic
954755935 3:52839940-52839962 ATAAACACATACCCCCAACCTGG + Exonic
956000317 3:64723049-64723071 TGAGACACATACCAGCAGCCAGG - Intergenic
958071051 3:88611992-88612014 TTGGAGAGATACAACCAAACTGG + Intergenic
959209678 3:103361954-103361976 TTGGACACATACACCCCCCCAGG + Intergenic
959606672 3:108249000-108249022 TTGGAAAAATTACACCAACCTGG + Intergenic
961417506 3:126771051-126771073 CTGGACACATACAACCTCCCAGG - Intronic
962496162 3:135941380-135941402 CAGGACACATACAACCTACCAGG - Intergenic
965955119 3:174360479-174360501 TTGGGCACATCCCACAAGCCAGG - Intergenic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
975220513 4:71808144-71808166 TTGGATACGTACTACCATCCAGG - Intergenic
976963484 4:91007507-91007529 CTGGACACATACAAGCTACCGGG - Intronic
978450030 4:108822371-108822393 TTAGACTCATACAACCAACTAGG + Intronic
983882760 4:172951899-172951921 TTGTTCATAAACCACCAACCAGG + Intronic
985542881 5:494961-494983 TTGGACAAATACCATCTCCCAGG - Intronic
991456046 5:66805782-66805804 TTGGAGACCTGCCACCACCCAGG - Intronic
992220045 5:74562863-74562885 TTGAACATATACCATGAACCAGG - Intergenic
994402578 5:99299848-99299870 CTGGACACATGCAACCTACCAGG + Intergenic
994580719 5:101638435-101638457 CTTGACACATACCACCCACAGGG - Intergenic
997928167 5:138049994-138050016 ATGGGCACATACCACCACACCGG - Intronic
998925526 5:147120188-147120210 CTGGAAACATACAACCGACCAGG - Intergenic
999013537 5:148070609-148070631 TTGGATAATTACCACCCACCTGG + Intronic
1005484717 6:26288961-26288983 TTGGACGCATATGGCCAACCAGG - Intergenic
1007307841 6:40920841-40920863 TTGGGCAGAAACAACCAACCTGG + Intergenic
1011982376 6:93397558-93397580 TTGAACACATAACACTATCCTGG - Intronic
1021727122 7:23558871-23558893 CTGGACACATACAAACTACCAGG - Intergenic
1021753654 7:23829853-23829875 CTGGACACATACAACCTACCAGG - Intronic
1022038575 7:26557639-26557661 ATGGACACAGACAACAAACCAGG - Intergenic
1027946512 7:84752719-84752741 CTAGACACATACGACCTACCGGG + Intergenic
1028982897 7:96986510-96986532 TTACACACATACCACATACCAGG + Intergenic
1033974952 7:147089682-147089704 TTGAATACATACAGCCAACCAGG + Intronic
1041607104 8:59794270-59794292 TTAGACACATACAACCTACCAGG + Intergenic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1042653953 8:71074295-71074317 CTAGACACATACAACCTACCAGG - Intergenic
1045790832 8:105982048-105982070 CTGGACACATAAAACCTACCAGG + Intergenic
1051694635 9:19754713-19754735 TTTGGCACATACCACCACCAGGG - Intronic
1060024750 9:120161688-120161710 TTGCACCCATACCTCCAGCCTGG - Intergenic
1060184623 9:121556745-121556767 TTGGAAGCATTTCACCAACCCGG - Intergenic
1060482747 9:124026964-124026986 TTGGACACTTATCACCCACCTGG - Intronic
1061211544 9:129196343-129196365 TTGGACCCCTACCACGCACCAGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186223157 X:7370910-7370932 ATGGACACGTGCCACCAACCTGG - Intergenic
1190250140 X:48717137-48717159 TGGGACACACACCACCAAATAGG + Intergenic
1191696995 X:64000487-64000509 ATCAACACAAACCACCAACCTGG + Intergenic
1191924301 X:66292692-66292714 CTAGACACATACAACCTACCAGG - Intergenic
1193288937 X:79748779-79748801 CTAGACACATACAACCTACCAGG - Intergenic
1196825955 X:119740397-119740419 ATTGACAAATAGCACCAACCTGG + Intergenic
1197399042 X:125966208-125966230 TTGGATATATACCACAAAGCGGG + Intergenic