ID: 974991645

View in Genome Browser
Species Human (GRCh38)
Location 4:69098779-69098801
Sequence CTGAAAGAAAGATGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 5, 2: 6, 3: 57, 4: 600}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974991645 Original CRISPR CTGAAAGAAAGATGGGAAAT GGG Intronic
900008662 1:86050-86072 GTGAAAGAAATATGGGAGAATGG + Intergenic
900036895 1:420061-420083 GTGAAAGAAATATGGGAGAATGG + Intergenic
900058522 1:655800-655822 GTGAAAGAAATATGGGAGAATGG + Intergenic
900864047 1:5254783-5254805 GATAAAGAAAGATGGAAAATGGG - Intergenic
901373564 1:8820839-8820861 ATTAAAGGAAGATGGAAAATGGG + Intergenic
901652242 1:10749695-10749717 CTGAAAGTAAGAAGAGAAACTGG - Intronic
902253041 1:15168344-15168366 CCAAAAGAAAGAAGGGGAATGGG + Intronic
902302463 1:15511833-15511855 CAGAAAGAAACAGGGGAACTGGG + Intronic
903840036 1:26232577-26232599 CTGAAAGAAAGAAGGAAAGAAGG - Intergenic
904243690 1:29169923-29169945 CTAAAACAAAGTTGGCAAATAGG - Intronic
905808736 1:40896561-40896583 CTGAAAGACAGAAAGGAAATTGG - Intergenic
906348693 1:45038471-45038493 AGGAAAGGAAGGTGGGAAATGGG + Intronic
906671066 1:47655394-47655416 CTGAAATAAATATGTGGAATAGG - Intergenic
906711048 1:47930185-47930207 CTGAAAGGCATCTGGGAAATTGG - Intronic
908449135 1:64233456-64233478 CAGAAAGAAAGATAGTCAATTGG + Intronic
908677914 1:66626835-66626857 CTGAAAGAAAGTTAGAAAATGGG + Intronic
908740007 1:67317741-67317763 TTGAAAGAAAGATGCGAAGGAGG - Intronic
909322072 1:74302276-74302298 GAGAAAGAGAGATGGGAAAATGG - Intronic
909938512 1:81582962-81582984 CTGAAAGAATGAAGCAAAATAGG - Intronic
910200853 1:84697144-84697166 CTGAAAGGAGGATGGGGAACAGG - Intergenic
911542908 1:99180299-99180321 ACGAAATAAGGATGGGAAATCGG + Intergenic
911731702 1:101298193-101298215 CAGGAAGAAACAGGGGAAATAGG - Intergenic
911756057 1:101558011-101558033 CAGAAATAGAGATGGGAAAGGGG - Intergenic
912246858 1:107968675-107968697 GTGAAGGCAAGTTGGGAAATAGG + Intergenic
912354766 1:109045897-109045919 CTGATAAAAATGTGGGAAATGGG - Intergenic
912865975 1:113256689-113256711 ATGGAAGAAATATGGGAAAAAGG - Intergenic
913157872 1:116117856-116117878 CAGAAAGAAAGAAGGGGAAAAGG - Intronic
913477303 1:119250470-119250492 CTGGAACAAAGAAGGGAATTTGG + Intergenic
914431213 1:147621272-147621294 TTAAAAGGAAGAGGGGAAATGGG + Intronic
914762755 1:150612301-150612323 CAGAAAGAAAGGTGAGAAAAAGG + Intronic
914810662 1:151025374-151025396 CTGAAAGCAAAATGAGAAACTGG - Intronic
915385854 1:155491217-155491239 GTGAAAGAGAGCTGGTAAATTGG - Intronic
915405445 1:155656608-155656630 ATGCAAGAAAAATGGGAATTGGG - Intergenic
916993384 1:170268816-170268838 GTGAAAAAAAGATTGGAAGTGGG - Intergenic
917208693 1:172607591-172607613 CTGAAAGAAAAGTGGGAACCCGG - Intronic
917448489 1:175126835-175126857 TTGAAAGAAGGAGGAGAAATGGG + Intronic
917576730 1:176330168-176330190 CTTAAAGAAAGACGGGTATTTGG + Intergenic
918675210 1:187276187-187276209 GTGAAAGAAATAGGGCAAATGGG - Intergenic
919821156 1:201472790-201472812 CGGAAAGAAAGATGGGAATAAGG + Intergenic
919960703 1:202465458-202465480 CTGAAATCTAGATGGGAAATAGG + Intronic
920236856 1:204513306-204513328 ATGAAAGAAAGAAATGAAATTGG - Intergenic
920681398 1:208075587-208075609 ATGAAAGTATGATGAGAAATAGG - Intronic
921784729 1:219216602-219216624 CTGAAAGGAAGAGGAGCAATAGG - Intergenic
922193026 1:223336301-223336323 GAGAAAGAAGAATGGGAAATGGG + Intronic
922984383 1:229854741-229854763 TTGACAGAAAGATGGAAAAAAGG - Intergenic
923651753 1:235880513-235880535 CAGAAAGAACCATGGGAAGTGGG + Intronic
923964707 1:239124618-239124640 CTGAAAGAAAGTTATGAAAGAGG - Intergenic
924158755 1:241208394-241208416 TGGCAAGAAAGATGGGAAAACGG + Intronic
924228141 1:241939876-241939898 ATTCTAGAAAGATGGGAAATGGG + Intergenic
924499172 1:244620394-244620416 GTGAATGAGAGATGGGAAACTGG - Intronic
924547728 1:245045871-245045893 CTGGTAGGCAGATGGGAAATTGG - Intronic
924643091 1:245852018-245852040 CCTTAAGACAGATGGGAAATAGG + Intronic
924910393 1:248505801-248505823 CCAACAGAAAGATGTGAAATGGG - Intergenic
924913707 1:248542238-248542260 CCAACAGAAAGATGTGAAATGGG + Intergenic
1062812813 10:478433-478455 GTGAGAAAAAGATGGGAATTGGG - Intronic
1063397625 10:5705730-5705752 TAAAAAGAAACATGGGAAATGGG - Intronic
1064644350 10:17445740-17445762 CTGAAAGAATGAAAGGAAACGGG + Intronic
1064784622 10:18880288-18880310 CTGAAAGCAAAAGGGGAAAAGGG + Intergenic
1065338153 10:24676230-24676252 CTTGAAGAATGATGGGAGATAGG - Intronic
1065959107 10:30719770-30719792 CAGAAAAAAACATGGAAAATAGG - Intergenic
1066413162 10:35193344-35193366 AGGAAAGAAAGAAGGGAAATGGG - Intronic
1066988711 10:42492016-42492038 ATAACAGAAAGTTGGGAAATAGG + Intergenic
1067363101 10:45600481-45600503 GTGAGAGGACGATGGGAAATAGG - Intergenic
1067664949 10:48269808-48269830 CTGTAGCACAGATGGGAAATGGG + Intronic
1068310084 10:55264585-55264607 CTGAAAGAAAGAAGGAAATGAGG + Intronic
1068732119 10:60370890-60370912 TTGAAAGTAATAGGGGAAATCGG + Intronic
1068794896 10:61068704-61068726 ATGAAAGAAGGTGGGGAAATGGG + Intergenic
1069142971 10:64851397-64851419 CAGAAAGATAGAAAGGAAATAGG - Intergenic
1069369281 10:67728833-67728855 CTGAAACAAAAATGAAAAATAGG + Intergenic
1071345581 10:84688740-84688762 CTGAGCAAAGGATGGGAAATGGG - Intergenic
1071956488 10:90766382-90766404 CTGAAAGTGGGATGGAAAATGGG - Intronic
1072456493 10:95580950-95580972 ATGAGAGAAAGTTGGGACATTGG - Intergenic
1073262113 10:102198342-102198364 TCGAACTAAAGATGGGAAATGGG - Intergenic
1073994303 10:109297573-109297595 TAGATGGAAAGATGGGAAATGGG - Intergenic
1073998268 10:109340905-109340927 GTGGAAGATAGATTGGAAATGGG + Intergenic
1074434042 10:113418601-113418623 GTGAAAGAAAGAAGGAATATGGG + Intergenic
1074524769 10:114253818-114253840 ATGAAAGGAAGATGGGAAAGGGG - Intronic
1077834333 11:5911062-5911084 CTGAGATTAAGATGGCAAATAGG - Intronic
1077995279 11:7447247-7447269 CAGAGAGAAAGATGGAGAATTGG - Intronic
1078128106 11:8587789-8587811 CTGAAAAAAAGATGGCAAAGGGG + Intronic
1078348839 11:10575830-10575852 TTGAAAATGAGATGGGAAATGGG + Exonic
1080213117 11:29810022-29810044 CTGTAATAATGATAGGAAATTGG + Intergenic
1080271142 11:30451962-30451984 CTCAAAGAAATGTGGGAAGTAGG + Intronic
1080313900 11:30926440-30926462 CTGTCAGAAAGGTGGAAAATGGG + Intronic
1081120401 11:39258145-39258167 CTCAAAGAAAGAGGGCAAAAAGG + Intergenic
1081330223 11:41792315-41792337 CTGAAAGAAGGAAGGGAATGAGG + Intergenic
1081338965 11:41903882-41903904 CTGTAAAAAAGAAGGAAAATGGG + Intergenic
1081710420 11:45212437-45212459 CAGAAACAAAGATGGAAAAGTGG - Intronic
1081987543 11:47317042-47317064 CTGAAAGAAAGGAGAAAAATAGG - Intronic
1083040993 11:59687373-59687395 ATGAAAGAAAGAAAGGAAAGAGG + Intergenic
1083312079 11:61789034-61789056 GTGAAAGGCAGATGAGAAATGGG + Exonic
1083334097 11:61912864-61912886 CAGAAACAAAGATGGGAAGGGGG + Intronic
1083628237 11:64082792-64082814 CTGAGGGAAACAGGGGAAATGGG - Intronic
1084981454 11:72831004-72831026 CTGAAAGAAAAATTTGAACTGGG - Intronic
1084999915 11:73023173-73023195 ATGAAAGAAAAATGATAAATTGG + Intronic
1085103841 11:73824837-73824859 CTCAAAGAAAGATGAGTAGTGGG + Intronic
1085152354 11:74262391-74262413 CAGAGAGAAAGAAGGGAAAGAGG + Intronic
1085323928 11:75592367-75592389 CTGAAACAAAGAAGGCAAAATGG + Intronic
1085520042 11:77132314-77132336 CTGAAAGATCCACGGGAAATGGG - Intronic
1085690878 11:78662766-78662788 CTGAAGGAGAGATGAGACATGGG + Intronic
1085731988 11:79007796-79007818 CTGAAAGAACAGTGGGAAGTTGG + Intronic
1085890624 11:80574248-80574270 CTCAGAAAAAGATGGGAAAATGG - Intergenic
1086060756 11:82697429-82697451 TTGAAAAAAATATGAGAAATCGG + Intergenic
1086343910 11:85875837-85875859 CTGAGAGAAAGATAATAAATGGG - Intronic
1087378688 11:97377220-97377242 CTCAAAGAAAGAAAGAAAATAGG - Intergenic
1087455698 11:98383571-98383593 CTGAAAGAAGGAAGGGAATGAGG + Intergenic
1087890786 11:103536135-103536157 ATGAAATAAAGATGGGAACTGGG + Intergenic
1087902854 11:103662068-103662090 ATGAAATAAAGATGGGGACTGGG + Intergenic
1087959170 11:104326480-104326502 CTGAAGGAAGGAGGGGAAGTGGG + Intergenic
1088702332 11:112424559-112424581 CTGAAAGAGAAGTGGGAAAAAGG + Intergenic
1089104993 11:115995316-115995338 CTGATAGAGAAAGGGGAAATAGG + Intergenic
1089376512 11:117998935-117998957 CTGACAGAACGCTGGGAAACAGG + Exonic
1089829164 11:121310149-121310171 CTGGGAGAAAGATGGAAACTAGG + Intergenic
1090044189 11:123316768-123316790 CTGAAAGAAAGAAAGAAAAAAGG + Intergenic
1090234965 11:125140351-125140373 CTGAAAGGAAGTAGGGAAGTGGG - Intergenic
1090562606 11:127948525-127948547 CTGAATGAAAGAGGGGTAAGAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091630441 12:2156055-2156077 GTGAAAGAAACATGGCAAAGGGG + Intronic
1091852392 12:3710492-3710514 TGGTAAGAAAGATGGGAAGTTGG + Intronic
1092338370 12:7654306-7654328 ATGAAAGAAAGAATGGAAAATGG + Intronic
1092344686 12:7705697-7705719 CTGATAGAAAGAGGGGAAGATGG - Intergenic
1092365622 12:7874113-7874135 CTAAAACAAAGATGGGAGTTGGG + Intronic
1092669687 12:10848840-10848862 TTGGAAGAAAAATGGGAATTTGG + Intronic
1093643693 12:21557151-21557173 ATGAAAGAAAGAAGTGAAAATGG + Intronic
1094186736 12:27651557-27651579 CTGACAAAAAGAGGGGAAAGAGG - Intronic
1094386554 12:29900719-29900741 CTGAAAGGAAGGTGGGAAACTGG + Intergenic
1094454418 12:30616476-30616498 CTGAAAGAAAAATTAGAAAATGG + Intergenic
1095228882 12:39710400-39710422 CTGCAATAAAGCTGTGAAATTGG - Intronic
1095273144 12:40245242-40245264 CTGAAAAAAAGAGGGGGAATTGG - Intronic
1095640171 12:44478130-44478152 CTGAAAGGAAAAGGGGAAATAGG + Intergenic
1096289157 12:50326226-50326248 CTGTGAGGCAGATGGGAAATTGG + Intronic
1096646410 12:53039624-53039646 CTGCAGGAAAGATGGCAAAAAGG + Exonic
1096880787 12:54668167-54668189 CGGGAAGAAAGAAGGGAAATGGG - Intergenic
1096944879 12:55392895-55392917 CATAAAGAAAGATGGAAAATTGG - Intergenic
1097255806 12:57673264-57673286 CTCACTGAAAGTTGGGAAATGGG - Intergenic
1097347247 12:58506827-58506849 TTCAGAGAAAGATGAGAAATTGG - Intergenic
1097801336 12:63917781-63917803 CAGAAAGCAGGGTGGGAAATTGG - Intronic
1098657716 12:73054034-73054056 TTTAAAGAACAATGGGAAATAGG + Intergenic
1100138434 12:91585431-91585453 CTGCAAGAGAGACTGGAAATGGG + Intergenic
1100857462 12:98770649-98770671 TTTAAAGAAAGATTGAAAATGGG - Intronic
1101012947 12:100470291-100470313 CAGAAAGAAAGAAGGGGAAAAGG - Intergenic
1101679203 12:106948354-106948376 CTGAAAGCAAGAAAGGAAAGTGG + Intergenic
1101740584 12:107496921-107496943 ATGAAAGAAAGATGGGAGAGGGG - Intronic
1102027893 12:109723793-109723815 CTGACAGGAAGATGGGACGTGGG - Intronic
1104174130 12:126312669-126312691 CCCAAAAAAAGATAGGAAATGGG + Intergenic
1104243092 12:127010141-127010163 CTGAAAGAAAGAAGGGAAGTAGG - Intergenic
1105947549 13:25202669-25202691 CTGAATGAAAAGTGGGAAACAGG + Intergenic
1106166168 13:27248431-27248453 CTGAAAGAAAGGTGGGAGAAAGG + Intergenic
1106628817 13:31448158-31448180 CTAAAATAAAGGAGGGAAATTGG + Intergenic
1106996050 13:35481455-35481477 CTGAAAAAAAAATGGGGAAAGGG + Intronic
1107066529 13:36219529-36219551 CAGAAAGAAATATGGGAGGTTGG + Intronic
1107107437 13:36660281-36660303 ATGAAGGAAAGAGGAGAAATGGG + Intergenic
1107261020 13:38491332-38491354 CTTAAAGAATGATGATAAATAGG + Intergenic
1107554124 13:41502571-41502593 CAGAAAGAAAGAATGAAAATAGG - Intergenic
1107579989 13:41772842-41772864 CTGCAAGAAAAAGGTGAAATTGG + Intronic
1107806704 13:44160173-44160195 AGGAATGAAAGATGGGAAACTGG - Intronic
1109108973 13:58292097-58292119 CTGAGAAAAAGATTGGATATGGG + Intergenic
1109140346 13:58707038-58707060 GTTAAAAAAAGCTGGGAAATAGG - Intergenic
1109151942 13:58858049-58858071 CTGAAAGAAGGAGGGGAATGAGG - Intergenic
1109184363 13:59251718-59251740 GAGAGAGAGAGATGGGAAATGGG + Intergenic
1109638509 13:65154596-65154618 CTGAAACTAAGATGGGCAATTGG + Intergenic
1109651138 13:65328102-65328124 AGGAAAGAAAGAAGAGAAATAGG + Intergenic
1109732683 13:66436578-66436600 CAGAAAGAAAGTTGGGACACAGG - Intronic
1110343775 13:74422847-74422869 CTGAAAGAAAATTAGGAATTAGG + Intergenic
1110429186 13:75403724-75403746 CACAAACAGAGATGGGAAATTGG - Intronic
1111025852 13:82522169-82522191 CTCAAAAAAAGAAGGAAAATAGG + Intergenic
1111835869 13:93387583-93387605 CTAAAAATAAGATGGGAAAATGG + Intronic
1112245523 13:97729986-97730008 CTGAAAGCAGGAGGGGAAAGGGG - Intergenic
1112553752 13:100447383-100447405 CAAAAAAAAAGATGTGAAATGGG + Intronic
1112845577 13:103638848-103638870 TTGAAAGACAGAAGGAAAATGGG - Intergenic
1113312288 13:109142553-109142575 CTGCACCACAGATGGGAAATTGG + Intronic
1113986200 13:114317792-114317814 TTGAATGGGAGATGGGAAATAGG + Intronic
1114338964 14:21723360-21723382 GAGACAGAAAGAAGGGAAATAGG - Intergenic
1114422072 14:22592683-22592705 CTGAAAGGATGAAGGGATATGGG - Intergenic
1114454312 14:22845392-22845414 CTGAGAGAAGGATGGGAATAGGG + Intronic
1115262819 14:31471019-31471041 CTGAAATAAAGAAGGGAATGGGG - Intergenic
1115531547 14:34332729-34332751 CTGAACGACAAATGGGAAATTGG + Intronic
1115945736 14:38658097-38658119 CTGAAAGAGAAAAGGGAAAGTGG - Intergenic
1116039148 14:39664576-39664598 CAAAAAGAAAGATGGGAGAGGGG - Intergenic
1116627587 14:47285617-47285639 CTTAAAGACACTTGGGAAATGGG - Intronic
1117534190 14:56688370-56688392 CTGAGAGGAACATGGGCAATGGG - Intronic
1117915958 14:60678114-60678136 CTGAAGCACAGATGGGAAACTGG - Intergenic
1117931661 14:60849036-60849058 CTGAAAGAAAGAAGGTGAGTGGG + Intronic
1118042537 14:61932743-61932765 CTGAAGCAAAGATGGGGAAGGGG - Intergenic
1118156595 14:63248539-63248561 CAGAAAAAATGATGGGAATTTGG + Intronic
1119698880 14:76736578-76736600 CTGAAATAAACATGGGAATGTGG + Intergenic
1119847416 14:77840845-77840867 CTGAAAGAAAGAAGGGCAGCAGG + Intronic
1120673145 14:87387536-87387558 GTGAAAGGCTGATGGGAAATTGG + Intergenic
1121960388 14:98254093-98254115 CTGAAAGATAGTTGTGAATTGGG + Intergenic
1121992181 14:98569002-98569024 CTGAATGAAAGATGAGAAGATGG - Intergenic
1122098010 14:99385628-99385650 TTGAAAGAAACCTGGGAAAAAGG - Intergenic
1122684780 14:103496731-103496753 AAGAAAAAAAGTTGGGAAATGGG + Intronic
1123936183 15:25195224-25195246 CTGAAAGACACAGGGGAGATTGG - Intergenic
1123989765 15:25674824-25674846 CTGAAAGCTGGAAGGGAAATGGG + Intergenic
1124026560 15:25972260-25972282 CTGAAAGAAAAATGGGAGCATGG + Intergenic
1125032061 15:35082977-35082999 CGGAAAGAAAAGGGGGAAATGGG + Intergenic
1125138212 15:36368941-36368963 CTGAAAGAAATATGGCAAGGAGG + Intergenic
1125297563 15:38219802-38219824 CTGATAGAAAACTGGCAAATTGG + Intergenic
1125408940 15:39384558-39384580 CTGAAAGAAGAAGGGAAAATGGG + Intergenic
1125485901 15:40110624-40110646 AGGAAAGAATGATGGGAAAAAGG - Intergenic
1127775480 15:62261036-62261058 CTGTGAGGCAGATGGGAAATTGG + Intergenic
1128457460 15:67840267-67840289 ATGAAGGAATCATGGGAAATAGG + Intergenic
1128510001 15:68307540-68307562 CTGGAAGGAAGAAGGGAAAGGGG - Intronic
1129025238 15:72565797-72565819 TGAAAAGAAAGATGGGGAATGGG - Intronic
1129186164 15:73908349-73908371 CTGGATGAAGCATGGGAAATGGG + Intergenic
1129836815 15:78713589-78713611 CTGAAAGAAAGGTAGTTAATAGG - Intronic
1130119149 15:81031890-81031912 AGGAAAGAAAGATGGGCAAGAGG + Intronic
1131070909 15:89465241-89465263 GTGCAAGAAAACTGGGAAATGGG + Intergenic
1131557146 15:93409617-93409639 CTGAAAGTAGGGTGGGAGATTGG - Intergenic
1131792970 15:95984702-95984724 TTGAAAGAAAGCTGGAAAATAGG + Intergenic
1133570379 16:7034512-7034534 CAGAAAGATGGATGGGAAGTGGG + Intronic
1133702322 16:8320453-8320475 CTGAAAAAAAGGCGGGGAATGGG - Intergenic
1133713299 16:8422463-8422485 CTGAAAGAAAAATGTGCAAAGGG - Intergenic
1133732322 16:8588556-8588578 CTGAAAGCAAGAAAGGAAATGGG - Intronic
1134258881 16:12634542-12634564 ATGAAAGAAAGATGGGAAAGAGG + Intergenic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1135500878 16:22994817-22994839 CAGAAAAAGAGATGGGATATAGG - Intergenic
1135607846 16:23838120-23838142 CTAAAAGACAGATTGCAAATTGG + Intronic
1137332558 16:47513635-47513657 CTGAGTAATAGATGGGAAATTGG - Intronic
1137723905 16:50644445-50644467 CATAAAGACAGATGGGAAAAGGG + Intergenic
1137823088 16:51464245-51464267 CTGCAAGAAATCTAGGAAATTGG - Intergenic
1140668248 16:77247895-77247917 CTGCAAGAAAGATTGGAGGTGGG + Intronic
1140976455 16:80064350-80064372 CTGAAATGAAGGTGGGACATGGG + Intergenic
1143381376 17:6498365-6498387 CTGACAGGAAGAGGGGAAAGTGG + Intronic
1144301173 17:13923926-13923948 CTGAAAGAAGGAAGGGAATGAGG + Intergenic
1146069488 17:29666996-29667018 CTGAAACAAAGATGATATATTGG + Intronic
1146524827 17:33557917-33557939 CTCAAAGAAAGAGTGAAAATGGG - Intronic
1147316887 17:39625314-39625336 CTGAAAGGAAGAAGGGGTATGGG - Intergenic
1147815637 17:43208013-43208035 CTGAAAGAAAGCTGGGAACTAGG + Intronic
1147887908 17:43696970-43696992 GTGAGAGAATGAAGGGAAATGGG - Intergenic
1148042045 17:44715516-44715538 ATGAAAGACAGATGCAAAATGGG - Intronic
1148550344 17:48546539-48546561 CTGGGAAACAGATGGGAAATGGG + Intergenic
1148824541 17:50382789-50382811 CTGAAGGAATGAGGAGAAATGGG - Exonic
1149268797 17:54954856-54954878 TTGCAAGAAACATGGTAAATGGG - Intronic
1149326674 17:55537826-55537848 GTGACAGAAATATGGGAAAAAGG - Intergenic
1150508364 17:65722238-65722260 CAGAAAGAAAGAAAGAAAATTGG - Intronic
1150594030 17:66588446-66588468 ATGAAAGAAAAATGAGAAATAGG + Intronic
1150671685 17:67205834-67205856 CTGAAAAAGAGATGGAAAAAAGG - Intronic
1150687683 17:67333705-67333727 ATGAAAGAAATATGGGAAAGTGG + Intergenic
1150936046 17:69636869-69636891 CTGAAAGCAAGTAAGGAAATGGG - Intergenic
1150949411 17:69785410-69785432 ATGAATGAGAGATGTGAAATAGG + Intergenic
1150960392 17:69905755-69905777 ATGAAAGACAGCTGGGGAATGGG + Intergenic
1151084104 17:71361285-71361307 CTGAGAGAAAGAGGCGAAAGCGG + Intergenic
1151637511 17:75361341-75361363 CTGAAGGAAAGATGTGCATTTGG - Intronic
1152150994 17:78601095-78601117 CTGAAAGAAAGCAGAGAAACAGG + Intergenic
1153073703 18:1136881-1136903 ATCAAAGAAAGGTGGTAAATTGG - Intergenic
1153465922 18:5387989-5388011 CAGAAAGAAAGGTGGGATACAGG + Intergenic
1153800660 18:8665552-8665574 CTGCAAGGCAGATGGAAAATTGG - Intergenic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1155626007 18:27835282-27835304 CTTAAAGAAAGAGGGGAATGTGG + Intergenic
1156872998 18:41969378-41969400 CAGAAAGAAACATGGGAACTTGG + Intronic
1157014284 18:43692021-43692043 CTGCAATAAAAATGAGAAATGGG - Intergenic
1158004650 18:52658452-52658474 CTGAATCAAAGAAGGTAAATGGG - Intronic
1158440454 18:57470441-57470463 CTGAAAGGAAGATGGGGCAGAGG - Intronic
1158979954 18:62750221-62750243 CCAAAAGAAAGATGAAAAATGGG - Intronic
1159245285 18:65797810-65797832 TTGAAAGACAGAGGAGAAATAGG - Intronic
1159463649 18:68751772-68751794 AGGAAAGAAAGATGGGAAAAAGG + Intronic
1160130984 18:76224664-76224686 CTGGAACAAAGCTGTGAAATGGG - Intergenic
1160640425 19:127610-127632 GTGAAAGAAATATGGGAGAATGG + Intergenic
1162049026 19:8021007-8021029 CTGAAAGAGAGACGGCAAAGTGG + Intronic
1162074982 19:8180236-8180258 GAGAAAGAAATATGAGAAATAGG + Intronic
1162282825 19:9713247-9713269 ATAATAAAAAGATGGGAAATAGG - Intergenic
1162788693 19:13052018-13052040 AGGAAAGACAGAAGGGAAATGGG - Intronic
1163983334 19:20922383-20922405 CTGAAAGAAAGATGGGCAACAGG + Intergenic
1164026425 19:21357512-21357534 CTAAAAGAAAGGTGGGCAACAGG + Intergenic
1164057884 19:21637638-21637660 CTAAAAGAAAGGTGGGCAACAGG + Intergenic
1164071046 19:21768443-21768465 CTAAAAGAAAGGTGGGCAACAGG - Intergenic
1164123012 19:22285203-22285225 CTGGAAGAAAGGTGGAAAATGGG + Intergenic
1164461520 19:28452968-28452990 CTGCAGGACAGATGGGAAACTGG + Intergenic
1164529806 19:29039822-29039844 CTGAAAGAAAGAGAGAAAATTGG + Intergenic
1164712155 19:30364605-30364627 CAGGAAGAAAGATGGAAATTGGG + Intronic
1165149616 19:33753296-33753318 CTGAAGAAAAGATTGGAGATGGG - Intronic
1165329735 19:35134809-35134831 CTGAAAGAAAGACGGAGAAGAGG - Exonic
1165530937 19:36400801-36400823 ATGAAGGGAAGCTGGGAAATAGG - Intronic
1166616735 19:44255584-44255606 CTGAAAAAAAGATATCAAATAGG + Intronic
1166909824 19:46145537-46145559 CTGGAAGCAAGATGGGAAGGTGG - Intronic
1168632335 19:57967271-57967293 ATAAAAGAAAGAAGAGAAATGGG + Intronic
1168639311 19:58020219-58020241 CTGAAAGAAGGATGGGAACTGGG + Intergenic
925636170 2:5943004-5943026 CTGAAGGAGAGATGGGAGGTTGG - Intergenic
925931799 2:8714173-8714195 CAGAAAGAAACCTGGGAAATGGG - Intergenic
926212254 2:10879678-10879700 CTGCACCACAGATGGGAAATTGG + Intergenic
926474173 2:13301962-13301984 CTGAAAGAAAAATGACATATAGG + Intergenic
926582535 2:14646963-14646985 CTCAGAGAAAGATGGTATATGGG + Intronic
926611315 2:14951175-14951197 CAGAAGAAAGGATGGGAAATAGG + Intergenic
926716992 2:15932569-15932591 CTAAAAGAAAGATGAAAAAATGG + Intergenic
926904213 2:17790903-17790925 CTGCAAGAAAGATGGTACTTTGG - Intronic
927297998 2:21477141-21477163 CTGAAAGATAAATGGGAGGTGGG + Intergenic
927361008 2:22233661-22233683 CTGTATGAAAGATGTGAAATTGG - Intergenic
927625485 2:24712856-24712878 CAGAAAGACAAATGGGAAGTAGG + Intronic
927751108 2:25672094-25672116 ATGAAAGACACATGGGAAAGTGG + Intronic
928144081 2:28755633-28755655 CTCAAAGAGGGGTGGGAAATGGG + Intronic
928752330 2:34485514-34485536 ATGGAAGAAAAATGGAAAATGGG - Intergenic
929606703 2:43239531-43239553 ATGAAAGAAAGATGTCAAAGTGG + Intronic
929978868 2:46660612-46660634 AAGAAAGAAAGATGGGCAACGGG - Intergenic
930955346 2:57196878-57196900 AAGAAGGAAATATGGGAAATGGG - Intergenic
931116228 2:59169680-59169702 CTGAAAATAAAATGGGAAATAGG - Intergenic
931207007 2:60157535-60157557 CTGAAAGAATGAATGGAAGTTGG - Intergenic
931997352 2:67852014-67852036 GTAAAAGAAAGAAAGGAAATTGG - Intergenic
932519768 2:72398393-72398415 CTGAGAGAGAGATTTGAAATTGG - Intronic
932886700 2:75555181-75555203 CTCAAAGAAAGACTGCAAATGGG + Intronic
933491208 2:82987052-82987074 GTGAAATAAAGGTGGCAAATAGG - Intergenic
935360737 2:102244515-102244537 ATGAATGAATGATGGGAACTTGG + Intergenic
936445387 2:112590706-112590728 CTTAATGACAGATGGGAAGTTGG - Intergenic
936816886 2:116471040-116471062 CTGATAGGAAGATAGGAAAGAGG + Intergenic
937062790 2:118992743-118992765 AGGAAAGAAAGAAGGGAAAGGGG - Intronic
937236949 2:120436901-120436923 CTGAATGAAAGATTGGGAAAGGG - Intergenic
937828290 2:126391558-126391580 CTGAAATAGAGCTGAGAAATTGG - Intergenic
939141005 2:138354533-138354555 TTGGAAGAAAGATGGCACATTGG + Intergenic
939177161 2:138761699-138761721 CTAAAATAAAGTTGGGAAAGTGG + Intronic
939221910 2:139312945-139312967 TTCAAAGAAAGATAGGAATTTGG - Intergenic
939789263 2:146551020-146551042 CTGAAACAAGGGTGGGAGATGGG - Intergenic
939885302 2:147675050-147675072 ATGAAAGAACGAGGGAAAATGGG - Intergenic
939940121 2:148339305-148339327 GTGAAAGAAAGCTGGGAAAGGGG - Intronic
940179726 2:150918600-150918622 ATGAAAGAAAGAAGGGAGAGCGG + Intergenic
941884939 2:170518383-170518405 CTAAAATAAGGATGGCAAATAGG + Intronic
941972992 2:171372248-171372270 TAGATAGCAAGATGGGAAATAGG + Intronic
942122619 2:172793192-172793214 CTTAAAAAAAGAGGGGAATTTGG - Intronic
942215951 2:173719245-173719267 CTGAAAAACAGATGGGAAAGTGG + Intergenic
942561567 2:177225327-177225349 CTGAAAGCTAGCTAGGAAATGGG + Intergenic
942694361 2:178623438-178623460 CTGAAAGAAGGAAGGGCAAGGGG - Intronic
942800544 2:179870281-179870303 CTGAATGCAACAAGGGAAATTGG - Intergenic
942807183 2:179945687-179945709 ATGTAAGAAAGAAGGGACATGGG - Exonic
942849816 2:180471370-180471392 CTGTTAGAAAGATGGAAAAGGGG - Intergenic
943123156 2:183763011-183763033 CTGAAAGAAATAGGGCAAATAGG - Intergenic
943473634 2:188327662-188327684 CTAAAAGAAATATGACAAATAGG - Intronic
943687731 2:190836819-190836841 CTGAAGGAAATTTGGGAATTAGG + Intergenic
944125250 2:196285393-196285415 CAGAAAGAAAAATGGAAGATCGG - Intronic
944279924 2:197884314-197884336 CTGGAAGAAAGATGGGGCATAGG + Intronic
944313813 2:198264321-198264343 CTGCAAGAAAGAAGGGAGATAGG + Intronic
944486602 2:200213361-200213383 CAGAAAGAAAGAAAGGAAAGAGG - Intergenic
944511247 2:200468445-200468467 TTGAAAGTAAGATTGCAAATTGG + Intronic
944982170 2:205133968-205133990 AGGAAAGGAAGAAGGGAAATGGG - Intronic
945246303 2:207720298-207720320 CTGAAAAAAAGGTGGAAAAAAGG - Intronic
945952466 2:216052794-216052816 CTGAAAGAGACATGAGAAACAGG - Intronic
946159660 2:217828397-217828419 GTCAAAGGAAAATGGGAAATAGG + Intronic
947103556 2:226646550-226646572 CTGAAAGGAGGAAGGGAAAAGGG + Intergenic
947236005 2:227941522-227941544 CTGAAAAAAAAATGGCAGATAGG - Intergenic
947354326 2:229276342-229276364 CTGAAAAGAAGATGGGAATTGGG + Intergenic
947680353 2:232025963-232025985 CTGAGAGACAGCTGGGAACTGGG + Intronic
947719488 2:232361620-232361642 CTGCTAGGCAGATGGGAAATTGG + Intergenic
947790612 2:232865863-232865885 CTCAAAGAATGATGGGAATATGG - Intronic
1169409289 20:5353621-5353643 CTGATAGAAACATGGAAAAGTGG - Intergenic
1170187529 20:13607580-13607602 GTTAAAGGAAGATTGGAAATTGG - Intronic
1170718726 20:18856187-18856209 CTCAGAGGAAGTTGGGAAATGGG + Intergenic
1170750956 20:19144574-19144596 CAGAAAGAAATCTGGAAAATCGG + Intergenic
1172074673 20:32285550-32285572 CTGAAAGGATGGTGGGAACTGGG + Intronic
1172122076 20:32604332-32604354 CTGTAAGATGGATGAGAAATGGG + Intronic
1172613635 20:36269012-36269034 CAAAAAGAAAAATGGGAAAAAGG + Intronic
1172732135 20:37096790-37096812 CTGCATGGCAGATGGGAAATTGG + Intergenic
1173012866 20:39198267-39198289 CTGAACTAAAGTGGGGAAATGGG - Intergenic
1173044164 20:39493544-39493566 CTCAAAGAAAGAAGGGACAGTGG - Intergenic
1173064214 20:39694426-39694448 CTGAAACAATGATGGGTATTTGG + Intergenic
1173074853 20:39808025-39808047 CTGTAGGAAAGAGGGGAAAATGG - Intergenic
1173469414 20:43311182-43311204 AAGAAAGAAAGAAGGGAAAAAGG + Intergenic
1173608276 20:44347613-44347635 ATGAAAGAAAGAAGGAAAAAGGG + Intronic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1174483895 20:50849436-50849458 CAGAAAGAAAGATGGGCAGAGGG + Intronic
1174707052 20:52667689-52667711 GTGGAAGAAGGATGGGAAAGGGG - Intergenic
1174842541 20:53913817-53913839 ATGATAGATAGATGGAAAATAGG - Intergenic
1175252023 20:57615584-57615606 CAGAAAGAAAGATGGGTCAGAGG + Intronic
1175605985 20:60312675-60312697 CTGAAAAAAAGATGTGAAAAGGG - Intergenic
1176957037 21:15117651-15117673 CTGAAATAAACACGGAAAATAGG + Intergenic
1177057595 21:16326991-16327013 CTGAGAGGAAACTGGGAAATTGG + Intergenic
1177585088 21:23081869-23081891 CAGAAAGAAAGAAAGAAAATGGG - Intergenic
1178427908 21:32493548-32493570 ATGAAAGAAAGAGCAGAAATTGG - Intronic
1179198798 21:39194107-39194129 CTGAAAGAAAAAATGGTAATTGG + Intronic
1179423965 21:41258143-41258165 CTGAAAAAAAAATGGTACATTGG + Intronic
1181493811 22:23276791-23276813 CAGAAAGAAAGATGCCAGATGGG + Intronic
1181537124 22:23552191-23552213 ATGAAGGATAGATGGGAAAATGG - Intergenic
1181537224 22:23552725-23552747 ATGAAGGATAGATGGGAAAATGG - Intergenic
1181760216 22:25053236-25053258 CTGAAAGTAACAAGGGAGATGGG - Intronic
1182107090 22:27697418-27697440 CTGGAATAAAGAGGGGAAGTTGG - Intergenic
1182697957 22:32208965-32208987 CTAAAAGACAGCTGGGAAAGAGG - Intergenic
1183600169 22:38835461-38835483 CTGAAGGAAAGAAGACAAATGGG + Intronic
1183861389 22:40672938-40672960 GTGCAAGAAAGATGGAATATGGG + Intergenic
949233763 3:1783643-1783665 TTGAAAGAAAAATGAGTAATGGG + Intergenic
949389414 3:3542749-3542771 CTGAGAGAAACAAGGGCAATAGG - Intergenic
949511989 3:4774421-4774443 CTGTAAAAAAAATGGGCAATAGG - Intronic
950661665 3:14470614-14470636 CTGCAAGACAGATGCAAAATGGG - Intronic
950927183 3:16753171-16753193 CTGCAACAAATATGGGAACTCGG + Intergenic
951834204 3:26963145-26963167 CTGCATGGCAGATGGGAAATTGG + Intergenic
952045076 3:29309214-29309236 CTGAAAAAAAGAGGAGATATAGG + Intronic
952652066 3:35738713-35738735 ATGAAAGAAAATTGGGAGATTGG - Intronic
953302330 3:41790569-41790591 TTGAAGGGTAGATGGGAAATAGG + Intronic
953411693 3:42693819-42693841 CTGCAGGAAAGATGGGAGAAGGG + Intronic
954927992 3:54254063-54254085 CTGTAAGAAACACAGGAAATCGG - Intronic
955208985 3:56923525-56923547 TTGGAAGGAAGAAGGGAAATGGG - Intronic
955668310 3:61374189-61374211 ATGAAAGGAAGATGGGAAAGGGG - Intergenic
955774503 3:62418932-62418954 CTGAATGAAAAATGGAACATGGG + Intronic
955935974 3:64102776-64102798 CTGAAAAAAAAATGGAACATGGG + Intronic
956658903 3:71581340-71581362 AGGAAAGAAAGAGGGGAAAAGGG + Intronic
956942190 3:74176011-74176033 CAGGGAGAAAGATGGGAAACGGG + Intergenic
957513222 3:81216554-81216576 CTGAAAAAAAGATGACAAAAAGG + Intergenic
957615419 3:82519960-82519982 CAGAAACAAAGAAGGGAAAAGGG + Intergenic
957707642 3:83810671-83810693 TTGAAAAAAAGCTGTGAAATTGG + Intergenic
957751829 3:84429464-84429486 ATGAAAAAAAGTTTGGAAATAGG - Intergenic
958639269 3:96783922-96783944 CTGAAAAGAAGTTGGTAAATGGG - Intergenic
958907669 3:99959964-99959986 CAGAAAAAAAGATGGGAGTTAGG + Intronic
960048262 3:113217537-113217559 AAGAAAGAGAGATGGGAGATGGG + Intronic
960485116 3:118242206-118242228 CTGAAAGATATATGGGGAAAGGG + Intergenic
961430453 3:126878713-126878735 ATGAAAGATTGTTGGGAAATAGG + Intronic
961606720 3:128100972-128100994 TTAAAAGAAAGAAGGGAAAAAGG - Intronic
961831504 3:129625348-129625370 CTGGAAGACAGATGGGGAAGGGG - Intergenic
961859662 3:129905560-129905582 ATGATAAAAAGTTGGGAAATGGG + Intergenic
961909734 3:130302252-130302274 CTGTAAAAAAGAAGGAAAATGGG + Intergenic
961990538 3:131185299-131185321 CTGATAGAAAGATTGGGAGTAGG + Intronic
962075396 3:132076432-132076454 CTGAAAAATAGATGAGAAAAGGG + Intronic
963036305 3:141032053-141032075 CAGATTTAAAGATGGGAAATTGG + Intergenic
964026498 3:152080457-152080479 CTGAAAGTAAGATATGAAATTGG - Intergenic
964034313 3:152177466-152177488 GGGAAAGAAAGAAGGGGAATTGG + Intergenic
964262720 3:154857619-154857641 CTGAAAAAAACCTGGCAAATTGG - Intergenic
964527970 3:157635652-157635674 AAGAAAGAAAGAAGGGAAAGAGG + Intronic
964635002 3:158848787-158848809 CTGGAAGATAGATGAGGAATAGG + Intergenic
965384533 3:168030189-168030211 TTCAGAGAAAGTTGGGAAATAGG - Intronic
965608457 3:170519831-170519853 CAGAAAGAAAAATGGAAAGTTGG - Intronic
965612317 3:170557345-170557367 CAGAAAGCAAGGTGGGAAATCGG + Intronic
965886926 3:173457422-173457444 GTAAAATAAATATGGGAAATTGG + Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
967009230 3:185416070-185416092 GTGAAAGCAAGATGGAAAATAGG - Intronic
967123021 3:186400394-186400416 CTGAATGAAAGCTGTGTAATGGG + Intergenic
967205364 3:187114659-187114681 ATGAAATAAAGAAGTGAAATGGG + Intergenic
967575495 3:191085913-191085935 CTGAGAGAAATATGTTAAATAGG + Intergenic
967665276 3:192164441-192164463 GTGAAAGAGTGAAGGGAAATGGG + Intronic
967857319 3:194128149-194128171 CTGAAAGGAAGATTGGAAGAGGG - Intergenic
968033978 3:195529486-195529508 ATGAAAGGAAGATGAGATATGGG - Intronic
968276121 3:197441685-197441707 CTGAAAGAAAGAAAGGAAGAAGG + Intergenic
968498875 4:934986-935008 CTGAAAGTGAGAGGGGAAGTAGG + Intronic
968889610 4:3361501-3361523 CTGAAAGCAAGATGGGGCCTGGG + Intronic
969197267 4:5573025-5573047 CTTGCAGAAAGATGGGAAACAGG - Intronic
969377932 4:6775489-6775511 GAGAAACAAAGATGGGTAATGGG + Intergenic
969449785 4:7266405-7266427 CTGAAAGAAAGAAGGGAGGAGGG - Intronic
970125238 4:12802288-12802310 CTGAATGAATGATGAGTAATGGG - Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970476387 4:16428177-16428199 CTTAAAGAAAGATGGAAGCTTGG + Intergenic
971434861 4:26609768-26609790 CTGGAAGATAGATTGGAAAAGGG + Intronic
971619743 4:28841148-28841170 ATGAAATGAAGCTGGGAAATGGG - Intergenic
971852335 4:31998092-31998114 CTGAAAGAAATATTGGAATAGGG + Intergenic
973250000 4:48050595-48050617 CAGAAAGCAAGAGGGGAATTGGG + Intergenic
974134667 4:57800134-57800156 CTTAAAGAAAGCAGGGAAGTGGG - Intergenic
974361189 4:60881945-60881967 AAGCAAGAAAGATGGGAAAATGG - Intergenic
974986307 4:69030365-69030387 TAGAAAGAAAGATGGGAAGTGGG + Intronic
974991645 4:69098779-69098801 CTGAAAGAAAGATGGGAAATGGG + Intronic
975000011 4:69212460-69212482 CTGAAAGAAAGATGGGAAGTAGG - Intronic
975005761 4:69282753-69282775 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975014170 4:69391702-69391724 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975015427 4:69411088-69411110 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975425168 4:74216893-74216915 GTGAATGAAAGATGGGACAAGGG - Intronic
975914816 4:79311991-79312013 GTGAAAGAAAGGTGAGAAAGAGG - Intronic
976036083 4:80822816-80822838 CTGTAAGAAAAATGAGGAATTGG + Intronic
977086696 4:92608100-92608122 CTGATAGAAAAATGGGAGGTAGG + Intronic
977189756 4:93984999-93985021 AAGAAAGAAAGATGTGAAACAGG + Intergenic
977679993 4:99787768-99787790 CTGAAAGAAACCTTGCAAATAGG - Intergenic
978012454 4:103704133-103704155 AAGAAAGAAAGAAAGGAAATTGG + Intronic
978293152 4:107170291-107170313 ATGAGAGAAAGGAGGGAAATAGG - Intronic
978454051 4:108868616-108868638 AAGAAAGAAAGAAGGGAAAAGGG + Intronic
978709443 4:111760804-111760826 CTGGTAGAAAGATTAGAAATTGG + Intergenic
979077031 4:116284697-116284719 CTGAAACCAAGCTGGCAAATGGG - Intergenic
979655987 4:123194881-123194903 CTGAAAGAAAATTGGTGAATAGG - Intronic
980420412 4:132552194-132552216 CCAAAGGAAACATGGGAAATAGG + Intergenic
981697140 4:147570283-147570305 CTTAAAGGAAGATGGAAACTTGG - Intergenic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
981912085 4:149993680-149993702 AAGAAAGAAAGAAAGGAAATTGG - Intergenic
982165549 4:152610698-152610720 ATGATAGAGAGATGGGAAAATGG + Intergenic
983305883 4:165986007-165986029 CTAAAAAAAAAATGGGAAAATGG - Intronic
984352919 4:178618897-178618919 CTGAAAGCCAGCTAGGAAATGGG + Intergenic
984496903 4:180509964-180509986 CCCAAAGAAACATAGGAAATTGG - Intergenic
984555945 4:181213926-181213948 CAGGAAGAAAAAGGGGAAATGGG - Intergenic
985735645 5:1579529-1579551 ATAACAGAAAGTTGGGAAATAGG - Intergenic
986271666 5:6236461-6236483 CTAAAACAAAGAAGGGAAAATGG + Intergenic
986365062 5:7021430-7021452 CTGAAAGAAGGAAGGGAATGAGG - Intergenic
987312824 5:16697380-16697402 CAGAAAGAAAGAAGGGAAAATGG + Intronic
988322072 5:29711785-29711807 CTAAAAGTAAGGTGGTAAATTGG - Intergenic
988819343 5:34865353-34865375 CTAGAAGTCAGATGGGAAATGGG + Intronic
989333523 5:40287978-40288000 TTGAAAGGAAGGTGGGTAATAGG - Intergenic
989451230 5:41588745-41588767 CTGGTAGAAAGAGGGGAAATGGG - Intergenic
990046076 5:51433467-51433489 GAGAAAGAAAGATTAGAAATTGG - Intergenic
990146635 5:52768491-52768513 CAGAAAGAAAGCTGAGAAGTTGG - Intergenic
990405480 5:55486239-55486261 CTCAAAGAAAAATGGGGAAAGGG - Intronic
991479669 5:67063835-67063857 CTTAAAGAAAGATTGGATGTAGG + Intronic
991952101 5:71956388-71956410 CTGTAAGAAAGCTGGGAAGGGGG - Intergenic
992153464 5:73929645-73929667 CTGAAATAAATATGGCAAAATGG - Intronic
992572634 5:78075577-78075599 ATCAAAGGAATATGGGAAATTGG - Intronic
993332494 5:86617925-86617947 TGAAAAGAAAGATGGGAAATGGG - Intronic
993526590 5:88973248-88973270 ATGAAAGAAAGAAAGGAAAGGGG + Intergenic
993802994 5:92367864-92367886 CTGACAGAAATATTGGAAAGTGG - Intergenic
994043210 5:95281607-95281629 ATAAGAGAAAGATGGGATATAGG - Intronic
994066827 5:95553111-95553133 CTGAATGTCAGATGGGAAGTAGG + Intronic
994315352 5:98326749-98326771 AAGATACAAAGATGGGAAATTGG - Intergenic
994372725 5:98985698-98985720 ATGAAAGAAACATGGGGAGTTGG + Intergenic
995059542 5:107798409-107798431 GTGATAGAAGGATGGGAAGTAGG - Intergenic
995358161 5:111263332-111263354 ATGAAGGAAAGATAGGAATTGGG + Intronic
996195124 5:120596022-120596044 CATAACTAAAGATGGGAAATAGG + Intronic
996608135 5:125347852-125347874 CTTAAAGACAGAAGGAAAATTGG - Intergenic
996688104 5:126307044-126307066 CTGAAAGATAGAAGGGGAAGAGG + Intergenic
996818992 5:127604998-127605020 CTATTCGAAAGATGGGAAATTGG + Intergenic
997017006 5:129947717-129947739 CTGATAGAAAGAATGTAAATTGG - Intronic
997247241 5:132360326-132360348 CTGAAAGACTGAGGGGAAAAGGG + Intergenic
997863202 5:137438252-137438274 CTCAAGGAGAGATGGGAAACTGG + Intronic
998823389 5:146077045-146077067 CTAAAAGGATGATGGGAAATTGG - Intronic
999196341 5:149784118-149784140 GTAGAAGAAAGAAGGGAAATAGG - Intronic
999857832 5:155614456-155614478 GGGAAAGAAAGAAGGGAAAGGGG - Intergenic
1000540541 5:162533749-162533771 CTGGAAAAAATAGGGGAAATGGG - Intergenic
1000565775 5:162845797-162845819 CTGAATTTAAGATGGGAATTTGG + Intergenic
1000672113 5:164075890-164075912 GAGAAAGTAAGATGGGAAATTGG + Intergenic
1000875606 5:166633963-166633985 CTGAAAGAAAGAAAGCGAATGGG - Intergenic
1000915853 5:167080459-167080481 CTGAATGAATGATTTGAAATAGG + Intergenic
1001686673 5:173598705-173598727 GAGCAAGAAAGATGGGCAATAGG - Intergenic
1002736926 5:181398805-181398827 GTGAAAGAAATATGGGAGAATGG - Intergenic
1002747774 6:76013-76035 GTGAAAGAAATATGGGAGAATGG + Intergenic
1003213283 6:4087199-4087221 CTAAAAGGAAGAGGGGAAAGCGG - Intronic
1004406508 6:15338224-15338246 CTGAAAGAAGGAAGGGAATGAGG + Intronic
1004934356 6:20492518-20492540 ATGAGATAAATATGGGAAATGGG - Exonic
1005043426 6:21620075-21620097 CTGAACGAAGGATGAGAACTTGG - Intergenic
1005726735 6:28656608-28656630 CTAAGAGAAAGATGGTAGATGGG + Intergenic
1006226846 6:32546033-32546055 CTTAGAGAAAGATGACAAATGGG - Intergenic
1006567849 6:34974422-34974444 ATGAAAGAAAGAAAGGAAAGGGG - Intronic
1006873028 6:37270595-37270617 ATGAGAGAAAGATGGGATAAAGG - Intronic
1007201097 6:40109758-40109780 CTTAGAGAAAGCTGGGAGATGGG - Intergenic
1007443000 6:41880244-41880266 GAGACAAAAAGATGGGAAATAGG + Intronic
1007700861 6:43765797-43765819 CAGAAAGCAAGATGAGAAAGAGG - Intergenic
1008500695 6:52179206-52179228 CTGAGAAAGAGATGAGAAATAGG - Intergenic
1008765597 6:54910073-54910095 AAGAAAGATAGATTGGAAATTGG + Intronic
1008854231 6:56062358-56062380 CTGAAATAAATATGGAAAAGAGG - Intronic
1009057096 6:58348971-58348993 CAGAAAGAAAGAAGGGTATTGGG + Intergenic
1009234144 6:61102591-61102613 CAGAAAGAAAGAAGGGTATTGGG - Intergenic
1009244795 6:61223488-61223510 CAGAAAGCAAGATTGGAGATGGG - Intergenic
1010166969 6:72926386-72926408 CAGATAGAGAGAAGGGAAATGGG - Intronic
1010185372 6:73137977-73137999 CTGGGAGAAAGATGGGATAGTGG - Intronic
1010532987 6:76990337-76990359 CTGAAAGAAAGAAGGGAAATGGG + Intergenic
1011326042 6:86150877-86150899 CTGAAAGAAGGAAGGGAATAAGG - Intergenic
1011869662 6:91876924-91876946 AGGAGAGAAAGATGGGAAAAGGG - Intergenic
1011974493 6:93278814-93278836 TTGAAAAAAAGTTGGGAATTAGG - Intronic
1011997731 6:93614397-93614419 CAGAATGGAGGATGGGAAATAGG - Intergenic
1012058435 6:94445954-94445976 CTGAAAGATGGAGGGGAAAAAGG + Intergenic
1014595384 6:123330819-123330841 CTGACAGAAAGATGAGTAAGAGG - Intronic
1014722246 6:124931708-124931730 CTGAAAAGAATATGAGAAATCGG - Intergenic
1014931926 6:127345393-127345415 TAAAAAGAAAGATGGAAAATGGG - Intergenic
1015214237 6:130731688-130731710 GTGAGAGAAAGGAGGGAAATGGG - Intergenic
1015416708 6:132957433-132957455 AAAACAGAAAGATGGGAAATTGG + Intergenic
1015532339 6:134233198-134233220 CTGAAAGAAGTATGAGAAAGCGG - Intronic
1015892220 6:137980295-137980317 GTAAAAGGAAGAAGGGAAATGGG - Intergenic
1015904408 6:138102357-138102379 ATGAAAGAAAGCTGGAAAGTAGG + Intronic
1015972639 6:138758175-138758197 CTGACAGGAAGAAGGAAAATAGG + Intronic
1016022365 6:139249576-139249598 CTGAATGAAAGCTGGCAGATTGG + Intronic
1016061271 6:139633572-139633594 CTGAAAGAAAGATGGAAGGAAGG - Intergenic
1016627715 6:146191704-146191726 CTGAAAAAAAGAAGAGAAATTGG - Intronic
1018276935 6:162142824-162142846 CTACTACAAAGATGGGAAATTGG + Intronic
1019242022 6:170674339-170674361 GTGAAAGAAATATGGGAGAATGG - Intergenic
1019855083 7:3597374-3597396 CTGAAAGAGTGATGTGAAAATGG - Intronic
1020376529 7:7493662-7493684 AGGAAAGAAAAAGGGGAAATGGG - Intronic
1020660185 7:10972966-10972988 CTGCAGGGCAGATGGGAAATTGG + Intergenic
1020816593 7:12913060-12913082 CTGAAAGGAAGGGGGAAAATTGG + Intergenic
1022312989 7:29214834-29214856 ATGAAAGAGAGATGAGAAAGAGG - Intronic
1022425999 7:30269353-30269375 CTGAAGGAGAGATGGTAAAGAGG - Intergenic
1022756030 7:33291444-33291466 CTGAAAGAAAGATATGTATTTGG - Intronic
1023573793 7:41602497-41602519 CTTAAAAAAAATTGGGAAATTGG + Intergenic
1023682402 7:42701093-42701115 CAGAAAGAAGGAGGAGAAATAGG - Intergenic
1023804375 7:43861420-43861442 ATGACAAAAAGTTGGGAAATAGG - Intergenic
1024475806 7:49808721-49808743 CAGAAGGAAATCTGGGAAATTGG + Intronic
1025157546 7:56622023-56622045 CTTAAAGAATGATGAGAACTTGG + Intergenic
1025776383 7:64564316-64564338 CTGGAAGAAAGGTGGGCAACAGG - Intergenic
1025864935 7:65372638-65372660 CTGGAAGAAAGGTGGGCAACAGG + Intergenic
1028442435 7:90879853-90879875 CTGAAAGCAACACGGGAAAGGGG + Intronic
1028466755 7:91161079-91161101 GTGAAAGAGATATGGGCAATTGG + Intronic
1028548935 7:92034847-92034869 CTGACAAAAAGGTGAGAAATAGG - Intronic
1028797110 7:94915709-94915731 GTGAAAGAAAGATGGGACATAGG - Intronic
1028799076 7:94940904-94940926 CTTACAGAAAGATGGGAGCTGGG - Intronic
1028820482 7:95205133-95205155 CAGACAGAAAGATGGGTAAAGGG + Intronic
1029166807 7:98597492-98597514 ATGAAAGAAAAATAAGAAATAGG + Intergenic
1029935186 7:104417024-104417046 GTGAAAGAATGTTGGGAAGTGGG - Intronic
1030647691 7:112081773-112081795 CAAAAAGAAAGATGGTAAATTGG + Intronic
1031125029 7:117763901-117763923 CTAAAAGAAGATTGGGAAATAGG - Intronic
1031423811 7:121581701-121581723 GTGAAAGAGAGATGAGAAATTGG + Intergenic
1031450482 7:121911670-121911692 CTGAAACTTAGATGGGAGATAGG + Intronic
1031670551 7:124538812-124538834 CAGAAAGAAAAATGAGAAATGGG + Intergenic
1031958023 7:127962192-127962214 CTGGAAGGAAGATGGGGAAAGGG + Intronic
1032535364 7:132658442-132658464 ATGAAAGAAAAGTAGGAAATAGG - Intronic
1032949750 7:136893825-136893847 CTGAAAAAAAGATGATAGATGGG + Intronic
1033004796 7:137550057-137550079 CTGAAAGACTTATGAGAAATGGG - Intronic
1033179537 7:139162367-139162389 CTGAAAGGAACATATGAAATAGG + Intronic
1033408645 7:141095599-141095621 CTGAAAGACAGAAAGCAAATGGG - Intronic
1034308240 7:150064036-150064058 CTGGAAGTACGATTGGAAATGGG - Intergenic
1034419460 7:150981409-150981431 TTGATAGAAAGAAGGGAAGTAGG + Intergenic
1034798614 7:154036635-154036657 CTGGAAGTACGATTGGAAATGGG + Intronic
1034920968 7:155081585-155081607 CTCACAGAAAGAGAGGAAATAGG - Intronic
1035506093 8:133762-133784 GTGAAAGAAATATGGGAGAATGG + Intergenic
1036082996 8:5578515-5578537 GTGAAAGTAAGATGAGAAACAGG + Intergenic
1036410910 8:8499672-8499694 ATGACAGAAAGATGGAAAATGGG + Intergenic
1037474141 8:19239697-19239719 CTGAAAAAAAGATAGAAATTTGG - Intergenic
1038228426 8:25678312-25678334 ATGAAAGAAAGAAAGGAAAGAGG - Intergenic
1038410791 8:27357621-27357643 CTGAATGAGAGAGGGGAAATGGG + Intronic
1039073228 8:33664870-33664892 GTGAATGAAAGATGAGAAAGTGG - Intergenic
1039128884 8:34237912-34237934 ATGAAAGAAAGAAAGGAACTTGG + Intergenic
1040353825 8:46595997-46596019 CTTAGAGAAGGATGGGGAATAGG + Intergenic
1040926971 8:52694758-52694780 TAGAAAGAAAACTGGGAAATTGG - Intronic
1041447183 8:57965137-57965159 CTGAAACAAAGCTTGGAAATGGG + Intergenic
1042556800 8:70040268-70040290 ATGAAAGAAAGATGGGAGGAAGG + Intergenic
1043153747 8:76751515-76751537 CTGACATAAAGATGGCAAATAGG - Intronic
1043614161 8:82104697-82104719 TGGAAAGAAAGATGGAAAATAGG + Intergenic
1045538398 8:103057451-103057473 CTGCATGGCAGATGGGAAATTGG - Intronic
1046582325 8:116108467-116108489 GTGACAGAAAGATGAGAGATGGG - Intergenic
1047274410 8:123395123-123395145 CTGAGAGAAGGTTGGGAACTTGG - Intronic
1047871624 8:129089208-129089230 ATGAAAGAAAGATTGGTGATTGG + Intergenic
1048027340 8:130598830-130598852 GAGAAGGTAAGATGGGAAATGGG - Intergenic
1048551281 8:135435949-135435971 CTGAAAGACAGGTGGGAATAAGG - Intergenic
1049165046 8:141120404-141120426 ATGATAAAAAGATGGGAAAGGGG - Intronic
1050299110 9:4238733-4238755 CTGGAAGAAAGATGTCAAGTGGG - Intronic
1050729141 9:8688200-8688222 CTGAAAGAATAATGGGATAAGGG - Intronic
1052235569 9:26210278-26210300 CTAAAAGAAAGAGGGCAAACAGG + Intergenic
1052286418 9:26790897-26790919 CTGAATGAAAGAAGGAAAAAAGG - Intergenic
1052617556 9:30861191-30861213 CTGAAAGAAATATGGGTTTTTGG - Intergenic
1053125429 9:35577062-35577084 CTGTAAAAAAGAAGGAAAATCGG + Intergenic
1053347142 9:37386267-37386289 CTTAAAGAAAAATGGGAATCCGG - Intergenic
1053398763 9:37799954-37799976 TTAAATGAAAGATGGCAAATAGG - Intronic
1053523424 9:38805004-38805026 CTGTAAGGAAGATGGTGAATAGG - Intergenic
1053579596 9:39390831-39390853 GTGAAAGAAAGGTAGGAAAGAGG + Intergenic
1054101183 9:60949640-60949662 GTGAAAGAAAGGTAGGAAAGAGG + Intergenic
1054122557 9:61225003-61225025 GTGAAAGAAAGGTAGGAAAGAGG + Intergenic
1054195652 9:62029423-62029445 CTGTAAGGAAGATGGTGAATAGG - Intergenic
1054585170 9:66957240-66957262 GTGAAAGAAAGGTAGGAAAGAGG - Intergenic
1054642755 9:67559266-67559288 CTGTAAGGAAGATGGTGAATAGG + Intergenic
1055389988 9:75810097-75810119 GTGGAAGAAAGAATGGAAATAGG - Intergenic
1055599681 9:77902861-77902883 GTAAAAGAAAGCTGTGAAATAGG - Intronic
1056319049 9:85419502-85419524 ATGAAAGATTGGTGGGAAATTGG - Intergenic
1057099741 9:92346973-92346995 CTGAAATAAAAATGAGAAAGAGG + Intronic
1057324843 9:94052268-94052290 CTGAAAGATAGTTGGGTAACTGG - Intronic
1057978509 9:99633434-99633456 CAGTAAGAAAGATGGGAAAGGGG + Intergenic
1058286064 9:103179991-103180013 CTGCAAGGAAGATTGAAAATGGG + Intergenic
1058639924 9:107073612-107073634 GTGACAGGAAGAGGGGAAATTGG + Intergenic
1058681484 9:107444139-107444161 CTGCAAGACAGATGAGAAAGAGG - Intergenic
1058855304 9:109056193-109056215 GTAAAGAAAAGATGGGAAATTGG + Intronic
1058867427 9:109174295-109174317 GGAAAAGAAAGATGGGAAAACGG - Exonic
1060614719 9:125002393-125002415 CTGAAAGAACTGTGAGAAATAGG - Intronic
1203602213 Un_KI270748v1:23573-23595 GTGAAAGAAATATGGGAGAATGG - Intergenic
1185801796 X:3017759-3017781 AAGAAAGAAAGAAGGGAAAATGG + Intronic
1185939341 X:4297989-4298011 CAGAAAGAATGAAGGGAAAAAGG - Intergenic
1186307824 X:8283181-8283203 ATGTAAGAAACATGGAAAATAGG - Intergenic
1187371269 X:18708761-18708783 CTGAAAGTAGGAAGGGACATAGG + Intronic
1187775733 X:22754483-22754505 GTGAAAGAAGAATGGGAACTAGG + Intergenic
1187786247 X:22890142-22890164 CTGAAAGAAAGAAGTGTAAATGG - Intergenic
1187856724 X:23644104-23644126 CTCACAGAAAGATGGGATAAAGG + Intergenic
1188217516 X:27497459-27497481 GGGCAAGAAGGATGGGAAATGGG - Intergenic
1188618342 X:32187814-32187836 CTGGAGAAAAGATGGGAAAACGG + Intronic
1188965180 X:36542623-36542645 TTAAAAGAAAAATGGAAAATTGG - Intergenic
1189244601 X:39553832-39553854 GTGAGAGAAAGAGAGGAAATGGG - Intergenic
1190433156 X:50397294-50397316 TCCAAAGAAAGATGCGAAATTGG + Intronic
1191119880 X:56892157-56892179 CTGAAAGTAATGGGGGAAATGGG + Intergenic
1191896466 X:65998355-65998377 ATGTAAGAAAGATGTGAAAAAGG - Intergenic
1192848600 X:74930325-74930347 CTGAAAGAGAGGTGAGAAAAAGG + Intergenic
1193052595 X:77116816-77116838 CTCAAATAAAGATGGGAATGTGG - Intergenic
1193615075 X:83677082-83677104 CTAAAAGAACTATGGGAAACTGG - Intergenic
1193954144 X:87837621-87837643 ATGAAATAAAACTGGGAAATGGG + Intergenic
1194312639 X:92331933-92331955 GAGAAGGAAAGATGGAAAATAGG - Intronic
1195313771 X:103658144-103658166 CTGTAAAAAAGAAGGAAAATGGG - Intergenic
1195381887 X:104278961-104278983 CATAAAGAAAGATGGGGAACAGG + Intergenic
1196102740 X:111864650-111864672 GGGAAAGGAAGATGGGAATTGGG + Intronic
1196207175 X:112954166-112954188 TTGAAAGTAAGATAGGAATTTGG + Intergenic
1196362335 X:114877422-114877444 ATGAAATAAAGATGGGAAGACGG - Intronic
1196472025 X:116039511-116039533 CCGATAAAAAGTTGGGAAATAGG + Intergenic
1197247652 X:124182711-124182733 AGGAAAGAAAGATGAGAAAAAGG - Intronic
1197669762 X:129263577-129263599 CTGTAACAAAGATGATAAATAGG - Intergenic
1197816502 X:130504238-130504260 GTGAAAGAAAGAGGGAATATAGG - Intergenic
1197992127 X:132329591-132329613 CAAAAAGAAGGAGGGGAAATGGG + Intergenic
1198271631 X:135061225-135061247 CTGTAAAAAAGAAGGAAAATGGG + Intergenic
1200620904 Y:5446078-5446100 GAGAAGGAAAGATGGAAAATAGG - Intronic
1201539726 Y:15092801-15092823 GTGAAAGAAAGAAGAGACATAGG + Intergenic
1201686657 Y:16712201-16712223 CTGAAAGCAAGATGGAAGACTGG + Intergenic
1202117103 Y:21479731-21479753 TTAAAACAAAGTTGGGAAATTGG + Intergenic
1202574961 Y:26314158-26314180 CTGAAATCTAGATGGGAAATAGG - Intergenic