ID: 974997125

View in Genome Browser
Species Human (GRCh38)
Location 4:69175256-69175278
Sequence CCATGGCACCTATAAAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974997125_974997132 14 Left 974997125 4:69175256-69175278 CCCAGGTTTTATAGGTGCCATGG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 974997132 4:69175293-69175315 GAAAACTTATAATTCTGAGAAGG No data
974997125_974997133 21 Left 974997125 4:69175256-69175278 CCCAGGTTTTATAGGTGCCATGG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 974997133 4:69175300-69175322 TATAATTCTGAGAAGGTGAATGG 0: 1
1: 3
2: 1
3: 29
4: 295
974997125_974997134 22 Left 974997125 4:69175256-69175278 CCCAGGTTTTATAGGTGCCATGG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 974997134 4:69175301-69175323 ATAATTCTGAGAAGGTGAATGGG 0: 1
1: 0
2: 4
3: 18
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974997125 Original CRISPR CCATGGCACCTATAAAACCT GGG (reversed) Intronic
900403775 1:2483688-2483710 CCATGGCCCCTGTAGCACCTTGG + Intronic
901888350 1:12240231-12240253 CCCTGGCAGCTGTACAACCTTGG - Intronic
902886339 1:19407587-19407609 CCAGGTCACCTGTGAAACCTGGG - Intronic
902953155 1:19903649-19903671 CCATGAGACCTTTACAACCTGGG - Intronic
905526275 1:38642237-38642259 CTATGGAACCCATAAGACCTAGG - Intergenic
909792125 1:79693093-79693115 CCATGGCAGCTATATGACCAGGG - Intergenic
909852389 1:80484402-80484424 AGATGGCAACGATAAAACCTAGG + Intergenic
910106755 1:83639557-83639579 CCATGTCACTTAAAGAACCTAGG + Intergenic
912191455 1:107345809-107345831 CCATGTCACATACATAACCTAGG - Intronic
912716225 1:111985550-111985572 AAATGGCACATATAAAACCAGGG - Intronic
915007210 1:152649797-152649819 TCAATGCAACTATAAAACCTGGG + Intergenic
920196166 1:204228668-204228690 CCCTGGCACCTAGGACACCTGGG - Intronic
920238738 1:204528333-204528355 CCATCACACCCATAAATCCTTGG - Intronic
1063010388 10:2016034-2016056 GCATGGCAGCAATAACACCTGGG + Intergenic
1073164140 10:101429152-101429174 TCATGGCACATATAAAAACAGGG - Intronic
1081868493 11:46372522-46372544 CCATGTCCCCCACAAAACCTTGG - Intronic
1083156700 11:60827857-60827879 CCAGGGCACCTGCAAAACCAGGG - Intergenic
1086909902 11:92460010-92460032 CCCTGGCAGCAATAAACCCTGGG - Intronic
1091097153 11:132834823-132834845 CCATTTCACCCATAACACCTTGG + Intronic
1091743109 12:2974098-2974120 CTAAGGCACCTTGAAAACCTGGG - Intronic
1093370030 12:18355050-18355072 CCATGGCACAGATAAGGCCTGGG - Intronic
1094261755 12:28508409-28508431 CCATGGGACCTATAAGGCCCTGG + Intronic
1105460090 13:20577043-20577065 CAATGAAACCTATAAAACATTGG - Intronic
1106084046 13:26524378-26524400 CCATCGCACCTGTAATCCCTTGG - Intergenic
1106388706 13:29314358-29314380 CCAAGGCAGCTATTAAACCCAGG + Intronic
1112336731 13:98522747-98522769 CCATGCCACTTATCATACCTGGG - Intronic
1119646359 14:76351322-76351344 CCATGCCCCCTATAAAACCCTGG + Intronic
1125244158 15:37615168-37615190 CCATGGAAGCCATAAAAACTAGG - Intergenic
1126754353 15:51910811-51910833 CTTTGGCCCCTATAAAACATTGG - Exonic
1129627027 15:77212246-77212268 CCTTGGCCACTAAAAAACCTGGG - Intronic
1130691281 15:86083613-86083635 CCATGGAACTTAGATAACCTCGG + Intergenic
1132837450 16:1961375-1961397 CCATGTCACCCCTAAAATCTGGG - Intronic
1133804780 16:9116663-9116685 CCATTGCACCACTAAGACCTAGG - Exonic
1139017645 16:62709529-62709551 CCATGGAAACCAGAAAACCTGGG + Intergenic
1144335655 17:14266944-14266966 CCATGGCTCCTAGAGAATCTAGG - Intergenic
1150246070 17:63676301-63676323 CCATCCCACCTGTAAAACCAGGG + Intronic
1150482575 17:65521908-65521930 CCATGGTCCCTCTGAAACCTCGG - Intergenic
1158621398 18:59035663-59035685 CCACGGCTCCTAGAAACCCTGGG - Intergenic
1161981381 19:7632207-7632229 GCATGGCCCCTGTATAACCTTGG + Intronic
1162575426 19:11496238-11496260 CCATGGGACCCATAAAGCCCCGG - Intronic
929937491 2:46304315-46304337 CCATGCTACCTATACGACCTTGG - Intronic
931919652 2:66999874-66999896 CTAAGGCACCTATATCACCTTGG + Intergenic
933232454 2:79824704-79824726 CCATGGCAGCTATACAATGTAGG - Intronic
933760353 2:85668180-85668202 CCATGGCACCTCTGCAGCCTGGG + Exonic
936052528 2:109235573-109235595 CCATGGCATCTCTCAAACCCAGG - Intronic
937250500 2:120520758-120520780 CCATGGCAACCATGAAACGTTGG - Intergenic
939738039 2:145873785-145873807 CCATGGCACTATTAAAATCTTGG - Intergenic
940668032 2:156632938-156632960 CCATGGGAACTATAAAAGCTTGG - Intergenic
942601183 2:177642793-177642815 ACATGTCACGTCTAAAACCTAGG - Intronic
942645070 2:178101728-178101750 GCAAGGAACCTCTAAAACCTTGG - Intronic
947156530 2:227167405-227167427 CCCTGACAGCTATAAAACCTGGG - Intronic
1169595484 20:7193711-7193733 TCAGGGCACCTATAAAGCTTTGG - Intergenic
1170745382 20:19094061-19094083 CCAGGGGACCTATTAAACCAAGG + Intergenic
1179039945 21:37793728-37793750 CCATGGTATATATAAAAGCTGGG + Intronic
1179257580 21:39730095-39730117 TCATGGCCCCTCTGAAACCTAGG + Intergenic
1180766275 22:18347380-18347402 CCATGGGACCTAGAGAACCAGGG - Intergenic
1180780038 22:18514998-18515020 CCATGGGACCTAGAGAACCAGGG + Intergenic
1180812754 22:18772319-18772341 CCATGGGACCTAGAGAACCAGGG + Intergenic
1181198912 22:21206567-21206589 CCATGGGACCTAGAGAACCAGGG + Intergenic
1181294586 22:21826170-21826192 CCATGGTACCTATAGTACATTGG - Intronic
1183108443 22:35630775-35630797 CCATGGCACAGCTAAAACTTGGG + Intronic
1183783447 22:40014842-40014864 ACATGGCAGCTTTATAACCTTGG + Intronic
1183884227 22:40864231-40864253 CCATGGCATCTGTAAACTCTTGG + Intronic
1203227893 22_KI270731v1_random:88270-88292 CCATGGGACCTAGAGAACCAGGG - Intergenic
952087871 3:29848465-29848487 CTAGGGCAACTATAAAACTTGGG + Intronic
952277681 3:31892976-31892998 CCACGGCACCCATACATCCTTGG + Intronic
960358289 3:116679607-116679629 CCAGGGCACCTGTAAGAACTTGG + Intronic
963212741 3:142711530-142711552 CAATGGCATCTATTAAATCTAGG - Exonic
964032977 3:152160740-152160762 CCATGTGACCTTTAAAACTTAGG + Intergenic
964222715 3:154365265-154365287 CCAGGGCACCTGTGGAACCTTGG - Intronic
964328919 3:155578833-155578855 CCCTTCCACCCATAAAACCTAGG + Intronic
966607399 3:181834865-181834887 CCATGCCGGCTAGAAAACCTGGG - Intergenic
974980880 4:68955846-68955868 CCATAGTACCTATACAGCCTGGG + Intergenic
974997125 4:69175256-69175278 CCATGGCACCTATAAAACCTGGG - Intronic
975007932 4:69313576-69313598 CCATGGTACCTATACAACCTGGG + Intronic
975010088 4:69340183-69340205 CCATGGTGCCTATACAACCTGGG - Intronic
977312626 4:95405690-95405712 CCATGGCAAATATATGACCTGGG - Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
979885187 4:126018326-126018348 CCAAGGCACCCATAATGCCTGGG + Intergenic
983890468 4:173024886-173024908 GCATGGCACTTATAAAAAGTGGG - Intronic
987537597 5:19208517-19208539 CCATGGAACCTGTAAGACCTAGG + Intergenic
988234737 5:28527629-28527651 CCAGGGCACCTTCAAAATCTAGG + Intergenic
992571494 5:78063773-78063795 CTACGACACCTATAAAAGCTTGG + Intronic
995342219 5:111072788-111072810 TCAGGGCACCTTTAAAGCCTGGG + Intronic
1003469231 6:6413287-6413309 CCATGGGACAGATAAAATCTAGG + Intergenic
1003936769 6:10982998-10983020 GCATGGCATCTGTATAACCTAGG + Exonic
1005711076 6:28503299-28503321 CCTTGGCACATATAAAAGCACGG - Exonic
1007389060 6:41539442-41539464 CCATGGAACCTGGAAGACCTGGG - Intergenic
1011520860 6:88204235-88204257 CAATGGAAACTATAAAACATTGG + Intergenic
1011699347 6:89941406-89941428 CCATGACACCTGTAAAATTTTGG + Intronic
1012374386 6:98543666-98543688 CCATGGCATCTAGAAGACCAGGG + Intergenic
1016983546 6:149876274-149876296 CCATGGCACCTATAAAATACTGG + Intergenic
1017445415 6:154503064-154503086 CCATGGCAGTTCTAAAAACTTGG - Intronic
1026428472 7:70320314-70320336 ACATGTCACTTATAAAACCTGGG + Intronic
1028107376 7:86895326-86895348 CCATTGCAACTATAAAAAATTGG - Intronic
1030170971 7:106602490-106602512 CCATGGCTGCACTAAAACCTAGG - Intergenic
1034151440 7:148918732-148918754 CCATAACCCCTATGAAACCTGGG + Intergenic
1041636806 8:60153888-60153910 CCATAAAACCTAGAAAACCTAGG - Intergenic
1047329533 8:123873905-123873927 CACTGGGACCTATAATACCTTGG + Intronic
1186326582 X:8484015-8484037 TCATGACTTCTATAAAACCTTGG - Intergenic
1188833048 X:34924461-34924483 CCCTGGCACTTTGAAAACCTTGG - Intergenic
1189102620 X:38207063-38207085 CCATGGCACCCATAATCCCCAGG + Intronic
1197821149 X:130542155-130542177 CCATGGCCCCAATGACACCTTGG - Intergenic
1202275028 Y:23108862-23108884 CCATGGCACCCAGAAGACCAGGG - Intergenic
1202291000 Y:23311827-23311849 CCATGGCACCCAGAAGACCAGGG + Intergenic
1202428019 Y:24742584-24742606 CCATGGCACCCAGAAGACCAGGG - Intergenic
1202442772 Y:24927507-24927529 CCATGGCACCCAGAAGACCAGGG + Intergenic