ID: 975007914

View in Genome Browser
Species Human (GRCh38)
Location 4:69313486-69313508
Sequence CAGAGTAGGAGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1155
Summary {0: 1, 1: 4, 2: 12, 3: 119, 4: 1019}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975007914_975007923 -4 Left 975007914 4:69313486-69313508 CCCTCCACCTTCCTCCTACTCTG 0: 1
1: 4
2: 12
3: 119
4: 1019
Right 975007923 4:69313505-69313527 TCTGGTCAGGTAGGATATATTGG 0: 1
1: 1
2: 0
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975007914 Original CRISPR CAGAGTAGGAGGAAGGTGGA GGG (reversed) Intronic
900124035 1:1061760-1061782 CAGAGGAGGAGGAAGGTTGAGGG - Intergenic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900540628 1:3200928-3200950 AAGAGGAGCAGGAAGGAGGAAGG + Intronic
900732594 1:4272038-4272060 AAGAGTAGGAGGAAGAAGGAAGG - Intergenic
901741323 1:11343987-11344009 CACATTAGGAGGAGGCTGGACGG - Intergenic
902718282 1:18287825-18287847 CAGAGAGGGAGGCAGGTGGAAGG - Intronic
902778921 1:18692199-18692221 AAGAAAAGGAAGAAGGTGGAAGG + Intronic
902843198 1:19088633-19088655 CAGAGTAGGAGGAAGGAACTAGG - Intronic
903067365 1:20708107-20708129 CAGATCAGGAGGGAGGAGGAGGG - Intronic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903331614 1:22599764-22599786 GAGAGAGGGAGGAAGGGGGAGGG + Intronic
903733484 1:25515165-25515187 GAGAGTGGGAGGAAGGAGGTTGG - Intergenic
904337970 1:29810331-29810353 GAGGGAAGGAAGAAGGTGGAGGG - Intergenic
904383111 1:30124720-30124742 CAGAGAAGGAGGGAGATGTAGGG - Intergenic
904755761 1:32767765-32767787 CCTAGTAGGAGGGAGGAGGAAGG - Exonic
904774170 1:32896547-32896569 CAGAGGAGCAGGAAGGTGAGAGG - Intronic
904917302 1:33979439-33979461 CACAGTAGGAGGAAGGGGCAGGG - Intronic
905243314 1:36595505-36595527 CAGAGGAGGAGGAAGCCGGCGGG - Intergenic
905410849 1:37766879-37766901 CAGAGGTGGAGGCAGGGGGAGGG - Intergenic
905524218 1:38624241-38624263 CGGAGTGGGAGGGAGGTGGGTGG + Intergenic
906210964 1:44011917-44011939 CACTGTGGGAGGGAGGTGGAAGG - Intronic
906737085 1:48140747-48140769 CAGAGTAGGAAAAAGGTTGATGG + Intergenic
906749349 1:48245208-48245230 AAGAGAAGGAGGAAGGAAGAAGG + Intronic
907306093 1:53513889-53513911 CAGGGAAGGAGGAAGGTGCTGGG + Intronic
907534882 1:55142498-55142520 CAAAAGGGGAGGAAGGTGGATGG + Intronic
907706820 1:56839619-56839641 CAGAGTGGGAGGCTGGTGGGGGG + Intergenic
907708341 1:56852559-56852581 CAAAGCATGAGGAAGGTGAAGGG + Intergenic
907926057 1:58956152-58956174 CACAGCAGGAGGTAGGTGGTGGG + Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908754043 1:67451567-67451589 GAGAGTGGGAAGTAGGTGGAGGG + Intergenic
908769667 1:67584731-67584753 CAGAGAAGGAGGGAGGAGAAAGG - Intergenic
909508145 1:76418367-76418389 CAGTGTAGCTTGAAGGTGGAGGG + Intronic
909573305 1:77142772-77142794 GAGAGAAGGAGGAAGGTGATTGG - Intronic
909585117 1:77281288-77281310 CAGTGGAGGAGAAAGGTGGGTGG - Intergenic
909724643 1:78819645-78819667 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
911147069 1:94562730-94562752 CACAGTAGGAGGAGAGTGGTGGG - Intergenic
911513057 1:98831640-98831662 CAGAGGAGGAGGGAGGAGTAGGG - Intergenic
911642752 1:100306426-100306448 CAGAGCAGGAGGAATGGGGGGGG - Intergenic
911811198 1:102284316-102284338 CAGAGCAGGAGGAAGTGGGTGGG + Intergenic
912283611 1:108344464-108344486 GAGGGTAGGAGGAGGGTGGAGGG + Intergenic
912548882 1:110471474-110471496 CAGAGTGGGAGAGAGGAGGATGG - Intergenic
912623117 1:111185731-111185753 CAGAGCAGGACAAAGGAGGAAGG + Intergenic
912728779 1:112082751-112082773 GAGAGAGGGAGAAAGGTGGAAGG + Intergenic
913058530 1:115183816-115183838 CAGAGGAGCAAGAAGCTGGAAGG + Intergenic
913508794 1:119543787-119543809 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913511903 1:119569755-119569777 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913516136 1:119607069-119607091 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913601101 1:120421733-120421755 CAGAGGAGGAGGAGGCTGGGAGG - Intergenic
914085944 1:144454868-144454890 CAGAGGAGGAGGAGGCTGGGAGG + Intronic
914191841 1:145418848-145418870 CAGAGGAGGAGGAGGCTGGGAGG + Intergenic
914362289 1:146945289-146945311 CAGAGGAGGAGGAGGCTGGGAGG - Intronic
914489385 1:148141794-148141816 CAGAGGAGGAGGAGGCTGGGAGG + Intronic
914589766 1:149096849-149096871 CAGAGGAGGAGGAGGCTGGGAGG + Intronic
915029091 1:152860808-152860830 CACAGCAGGAGGGAGCTGGAGGG - Intergenic
915585979 1:156844261-156844283 CAGAGGAGGAGGATGCTGGGGGG - Exonic
915626799 1:157118812-157118834 CAGGGTTGAAGGAAGGTGGGAGG + Intergenic
915799585 1:158775614-158775636 GAGAGTAGGAGAAAGGAGCATGG + Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
916015968 1:160750209-160750231 CAGGCTGGGAGGAAGGTGGCAGG + Intronic
917168560 1:172143503-172143525 GAGAGGGGGAGGAAGGTGGGAGG - Intronic
917170239 1:172164798-172164820 CAGTGTATGAGGAAGGTAGTGGG + Intronic
917313594 1:173702595-173702617 AGGAGAAGGAGGAAGGAGGAAGG + Intergenic
917354710 1:174114998-174115020 CACAGAAGGAGGAAGGGAGAAGG - Intergenic
917490338 1:175493272-175493294 CAGAAAAGGAGAAAGGTGAAAGG + Intronic
917974321 1:180229618-180229640 AAGAGGAGGAGGAAGATAGATGG + Intergenic
918015850 1:180632025-180632047 GAGAGGAGGAGGAAGATGGCGGG + Exonic
918095311 1:181329488-181329510 CAGAGTAGCTGGAAGCTGGTGGG - Intergenic
918146147 1:181757851-181757873 CAGAAGAGGAGGACGGTGAATGG - Intronic
919101509 1:193102862-193102884 CTGGGTAGGAGGAAGCTAGATGG - Intronic
919434828 1:197544961-197544983 AGGAGAAGGAGGAAGGAGGAAGG + Intronic
919775943 1:201194101-201194123 CCCAGGAGGAAGAAGGTGGAAGG + Intronic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920377692 1:205518077-205518099 CAGAGTAGGTGTAAGGTGAGGGG - Intronic
920847565 1:209606800-209606822 CAGAGTGGGAGAAAGGAGTAGGG - Intronic
920864811 1:209743179-209743201 AAGAGAAGGAGGAAGGTGAAGGG + Intergenic
921485337 1:215708763-215708785 CACAGCAGGAGGTAAGTGGAGGG - Intronic
922145557 1:222940301-222940323 CAGAGAAGGAGAAAGTTGGCCGG + Intronic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922362280 1:224834115-224834137 CACAGGAGGAGGAAGGAGGGAGG - Intergenic
922413744 1:225400249-225400271 CAGAGTCTGAGGTAGGAGGATGG + Intergenic
922602075 1:226864057-226864079 CAGCGTAGGAGGAATGTGGCTGG + Intergenic
922722595 1:227906379-227906401 TGGAGTAGGAGGAGGGAGGAGGG - Intergenic
922822487 1:228493908-228493930 CAGAGCTGGAGGCAGGAGGATGG + Exonic
923082310 1:230669913-230669935 CAGTGTACGAGGAAGGTGCAGGG + Intronic
923211135 1:231805474-231805496 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
923267157 1:232325902-232325924 AAGAGGAGGAGGAAGGAGAAAGG + Intergenic
923401034 1:233615178-233615200 CAGAGTAGGAGGAAGGGTGAGGG + Intronic
923453113 1:234138366-234138388 CAGAGGAGGAGGAGGGTCAATGG + Intronic
923546538 1:234927568-234927590 CAGAGTAGAGGTGAGGTGGAGGG - Intergenic
924608658 1:245556254-245556276 AAGAGGAGGAGGAGGGAGGAAGG - Intronic
924854810 1:247865613-247865635 CAGACTGGGAGGAAGCTGCACGG - Intronic
1062812591 10:477609-477631 ATGGGTGGGAGGAAGGTGGATGG + Intronic
1062951050 10:1503799-1503821 CAGAGTAGGAGCAAGGGGGCGGG - Intronic
1063159462 10:3408776-3408798 GGGAGGAGGAGGGAGGTGGAGGG + Intergenic
1063159511 10:3408962-3408984 AGGAGGAGGAGGGAGGTGGAGGG + Intergenic
1063470112 10:6277623-6277645 CAGAGCAGGAGGGAGGTGCGGGG - Intergenic
1063858604 10:10283571-10283593 CAGAGGAGGGGAAAGGAGGAGGG - Intergenic
1064190127 10:13198593-13198615 CAGAGGAGGAGGGAGTGGGAGGG + Intronic
1065399810 10:25286258-25286280 CAGAGTGGGAGGCAAGGGGAAGG - Intronic
1065490537 10:26277645-26277667 CAGAGAAGGAAGTAAGTGGATGG + Intronic
1065780461 10:29162054-29162076 CAGAGAAGGGGGAGGGTGGAGGG - Intergenic
1065886688 10:30084157-30084179 GAAAGAAGGAGGAAGGAGGAAGG + Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066208585 10:33213871-33213893 CAGAGCAGGAGGAAGGTTTGAGG - Intronic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1066696094 10:38078801-38078823 CAGAGCAGGAGCAAGGTAGGAGG + Intergenic
1066996444 10:42568737-42568759 CAGAGTAGGAGCAAGGTAGGAGG - Intergenic
1067083822 10:43227917-43227939 CAGAGAAGGAGGAGGAGGGAAGG - Intronic
1067143144 10:43673032-43673054 CAGAGGAAGAGGTAGGTGGTTGG - Intergenic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1067685341 10:48463514-48463536 CAGAGCTGGAGGAAAGGGGAGGG - Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1068208842 10:53893797-53893819 CAGAGTGGGAGGAAGGTGAGGGG + Intronic
1068210806 10:53917912-53917934 CAGAGCAGGAGCAAGAGGGAGGG - Intronic
1068764683 10:60750018-60750040 GAGAGTAGGAGGAGGGTGGGAGG + Intergenic
1068865065 10:61886374-61886396 CACAGTTGGAGGGAGGTGGCTGG - Intergenic
1068891355 10:62151295-62151317 CAGAGCAGGAGGAAGGGGATGGG - Intergenic
1069180022 10:65347312-65347334 CAGAGGAGGAGGAAGAAGAAAGG + Intergenic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069777762 10:70936755-70936777 CAGAGGAGGAGGGTGGAGGATGG - Intergenic
1069817279 10:71206415-71206437 CAAAGCAGGAGGAAGGAGGTGGG + Intergenic
1070079957 10:73176318-73176340 CAGAGCAGGAGGTAAGTGGCAGG - Intronic
1070354586 10:75627303-75627325 CAAAGTGGGAAGCAGGTGGAAGG + Intronic
1070392795 10:75985723-75985745 CAGAGATGGAGGGAGGTGGGAGG + Intronic
1070465775 10:76722203-76722225 CAGAGTAGGAAGAAAGTTAAGGG - Intergenic
1070839426 10:79473310-79473332 CAATGTAGGAGGAAGATCGAAGG + Intergenic
1071203814 10:83251734-83251756 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1071388924 10:85150372-85150394 AAGAGGAGGAGGAAGGAGTAAGG - Intergenic
1071990006 10:91092487-91092509 TAGAGTAGGAGGAAGAGGGGTGG + Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072868348 10:99088348-99088370 AAGGGTAGGAGGTAGGTGAAGGG - Intronic
1073030803 10:100524146-100524168 GAGAGAAGGAGAAAGGGGGAGGG + Intronic
1073188769 10:101635028-101635050 CACAGTAGGAGGTAAGTGGTGGG + Intronic
1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG + Intronic
1073944069 10:108730266-108730288 GGGAGTTGGAGGGAGGTGGAGGG + Intergenic
1074722514 10:116274490-116274512 AAGAAGAGGAGGAAGGAGGAGGG + Intergenic
1074783310 10:116817980-116818002 GAGAGGAAGAGGAAGCTGGAGGG - Intergenic
1075452516 10:122561826-122561848 CAGAGAAGGAGGAGGAGGGAGGG - Intronic
1075590687 10:123688972-123688994 AAAGGTAGGAGGAAGGTGGCTGG + Exonic
1076107339 10:127834257-127834279 CTGGGCAGGAGGAAGCTGGAGGG - Intergenic
1076148679 10:128145644-128145666 CAGAGTAGGAAGAAGAGAGAAGG - Intergenic
1076169526 10:128307899-128307921 GAGAGAAGGACAAAGGTGGAGGG - Intergenic
1076318879 10:129564217-129564239 AAGAGGAGGGGGAAGGGGGAAGG - Intronic
1076745552 10:132511264-132511286 CAGAGGAGGAGGAAGAGAGATGG + Intergenic
1076858929 10:133130609-133130631 CAGACAAGGAGGAAGAGGGAGGG - Exonic
1077272221 11:1686732-1686754 CAGAGAAGGAGGGAGGAGGGAGG - Intergenic
1077447663 11:2606494-2606516 AAGAGCAGGAGCAAGGTGGAGGG - Intronic
1077833397 11:5900807-5900829 CCCACTACGAGGAAGGTGGAAGG - Exonic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1077993526 11:7433124-7433146 CAGAGCAGGAGCAAGGGGGGTGG - Intronic
1078042302 11:7879119-7879141 CAGAGCAGGAGGAAGAGGGTGGG + Intergenic
1078535746 11:12172141-12172163 CAAAGCAGGAAGAAGGTAGATGG + Intronic
1078860907 11:15245291-15245313 AAGAGTATGAGCAAGGAGGAGGG + Intronic
1079175708 11:18138098-18138120 CTGAGGTGGATGAAGGTGGAGGG + Exonic
1079181455 11:18197275-18197297 CTGAGGTGGATGAAGGTGGAGGG + Intronic
1079263760 11:18910482-18910504 CTGAGGTGGATGAAGGTGGATGG - Intergenic
1079265999 11:18933867-18933889 CTGAGGTGGATGAAGGTGGAGGG - Exonic
1079328740 11:19516696-19516718 GAGAGTAGGAGAAATGAGGACGG + Intronic
1079343539 11:19632691-19632713 CTAAGTAGGAGAAAGGTCGAAGG - Intronic
1079697084 11:23495362-23495384 AAGAGAAGGAGGAAGGTGGAGGG + Intergenic
1079809835 11:24983406-24983428 AAGATTAGGAGGAAAATGGAAGG + Intronic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1080823098 11:35825625-35825647 CAGACTAGGTTGCAGGTGGAGGG + Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081197678 11:40181189-40181211 GAGAGATGGAGGAAGGAGGATGG - Intronic
1081282341 11:41225135-41225157 CCGGGTAGGAGGAAGATGTACGG + Intronic
1082089628 11:48078610-48078632 CAGTCTAGGAGGGAGGTGGCAGG + Intronic
1082772256 11:57217198-57217220 CCCAGGAGGAGGAAGGTGGTGGG - Intergenic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083193488 11:61069004-61069026 AAGAGAAGGGGGAAGGGGGAGGG - Intergenic
1083296850 11:61719637-61719659 CAGGGCAGGAGGAAGGCTGAAGG - Intronic
1083298725 11:61729038-61729060 CAGAGTGGGAGGGATGGGGACGG - Intronic
1083443134 11:62690021-62690043 CAGAGGAGGGGGATGGTGTAGGG - Intergenic
1083661929 11:64255465-64255487 CAGGGCAGGAGGAAGGTGCTGGG - Intronic
1083777627 11:64902037-64902059 CAGAGGAGAAGGAAGATGAAAGG - Exonic
1083785141 11:64940672-64940694 CAGTGTAGGAGGAAAGTTTAAGG - Intronic
1083880088 11:65544063-65544085 CAGAGCAGGAGGAATGAGGAAGG - Intronic
1083904188 11:65659603-65659625 CTGAATAGGAGGAAGGGGGTTGG - Intronic
1084144599 11:67257843-67257865 CAGAGAAGGAGGAAGCTAGTTGG + Exonic
1084430218 11:69106796-69106818 CTGAGTGGGAAGATGGTGGAGGG - Intergenic
1084560295 11:69901495-69901517 GAGAGTTGGGGGAAGGCGGAAGG - Intergenic
1085300436 11:75455368-75455390 GAGGGCAGGAGGAAGGTGGGGGG + Intronic
1085310039 11:75510752-75510774 CGGAGGAGGAGGAGGGGGGAGGG - Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1086016840 11:82178547-82178569 CAGAGGAGGAGGAAGTATGATGG - Intergenic
1086147904 11:83574167-83574189 TGGAGTTGGAGAAAGGTGGAGGG + Intronic
1086229026 11:84546288-84546310 CAGAGCAGGAGGAAGAGAGAGGG - Intronic
1086571640 11:88291527-88291549 GAGGGAAGGAGGAAGGAGGAAGG + Intergenic
1086929925 11:92681835-92681857 CAGTGTGGGAGGGAGGAGGAGGG + Intronic
1087076987 11:94134658-94134680 GAGAGAAGGAGGAAGAGGGAGGG - Intronic
1087276821 11:96169343-96169365 CAGAGCAGGAGGAAAGAGAATGG - Intronic
1087433217 11:98080021-98080043 CAGAGCAGGAGGAAGGAGCAGGG - Intergenic
1087817919 11:102679387-102679409 GAGAGTAGGAGGAGGGTGGCGGG + Intergenic
1087931391 11:103982064-103982086 CAGAGTAGGATCAAGGTTGGAGG - Intronic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1088314845 11:108497690-108497712 CAGAGCCGTAGGAAGGAGGAGGG - Intronic
1088455846 11:110032343-110032365 CAGAGAGGGAGGAAAATGGAAGG - Intergenic
1089603595 11:119629066-119629088 CAGAGCAGGAGGGAGGTGGGTGG + Intronic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089627306 11:119759589-119759611 CAGGGTTGGAGGAGGGTTGAGGG + Intergenic
1089748328 11:120632587-120632609 AAGAGCAGGAAGAAGGTGGCTGG - Intronic
1090034056 11:123232835-123232857 CAGAGTAGTAGAAAGATGTAAGG - Intergenic
1090213461 11:124939536-124939558 TAGAATGGGAGGAAGGAGGAAGG + Intergenic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1090911301 11:131121929-131121951 CAGAATAACAGGGAGGTGGAAGG + Intergenic
1090996453 11:131870188-131870210 CACAGTAGAAAGAAAGTGGATGG + Intronic
1091026939 11:132149769-132149791 CAGTGTGGGAGGGAGATGGAGGG + Intronic
1091060838 11:132460523-132460545 CAGGGCAGGAGGAAGATGTATGG + Intronic
1091198351 11:133750844-133750866 GAGAGTGGCAGGAAGGTGTAGGG + Intergenic
1091441037 12:511929-511951 CAAAGGTGGAAGAAGGTGGAAGG - Intronic
1091441146 12:512380-512402 CAAAGGTGGAAGAAGGTGGAAGG - Intronic
1091441229 12:512719-512741 CAAAGGTGGAAGAAGGTGGAAGG - Intronic
1091441310 12:513051-513073 CAAAGGTGGAAGAAGGTGGAAGG - Intronic
1091624598 12:2112477-2112499 GAGAACAGGAGGAAGGTGAAGGG + Intronic
1091720613 12:2810682-2810704 CATAGTGGGAGGAGGCTGGAGGG - Intergenic
1092068774 12:5615524-5615546 GACAAGAGGAGGAAGGTGGACGG - Intronic
1092122673 12:6055505-6055527 CAGAGCTGGAGGAATGGGGAGGG + Intronic
1092228528 12:6764447-6764469 AAAAATAGGAGGAAGGTGGATGG + Intronic
1092282613 12:7109071-7109093 CAGAGGAGGAGGGAAGAGGACGG - Intronic
1092739847 12:11616893-11616915 CAGAACAGGAGGAAGATGGTGGG + Intergenic
1092986615 12:13851929-13851951 CAGAGGAGGAGGAGGGTGGGTGG + Intronic
1093242504 12:16695550-16695572 GAGAGGAGGAGGAAGGGGGGAGG + Intergenic
1093764018 12:22942128-22942150 CAGAGCAGGAGGAAGGAGTAGGG - Intergenic
1094086667 12:26600736-26600758 CAGAGCAGGAGAAAAGGGGATGG - Intronic
1094136781 12:27136113-27136135 AAGAGGTGGAGGATGGTGGAGGG + Intergenic
1094691783 12:32776487-32776509 AAGAGAAGGAGGAAAGTAGAAGG + Intergenic
1095143067 12:38690665-38690687 CAGAAAAGGAGAAAAGTGGAGGG + Intronic
1095409436 12:41906152-41906174 ATGAGTAGGAGTGAGGTGGAGGG - Intergenic
1095509256 12:42932009-42932031 AGGAGTAGGAGAAAGGGGGAAGG + Intergenic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1095833502 12:46612551-46612573 AAGAAAAGGAGGAAGATGGAAGG - Intergenic
1096016477 12:48280740-48280762 CAGAGAAGGAGGAAGGACGAGGG - Intergenic
1096085977 12:48865377-48865399 CAGGGACGCAGGAAGGTGGAGGG + Intronic
1096273462 12:50185387-50185409 CACATTAGGAGGAAAGTGGAAGG + Intronic
1096470334 12:51871592-51871614 CAGAGTGGGGGGCTGGTGGAGGG + Intergenic
1097173244 12:57128851-57128873 CAGAGAAGGAGGAGGGGGAAAGG + Exonic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1097971914 12:65642190-65642212 CAGCGCAGCAGGAAGGGGGAAGG + Intergenic
1098260755 12:68668038-68668060 CAGAGTGGAAGGATGGGGGAGGG - Exonic
1098391099 12:69970917-69970939 CAGAGCAGGAGGAAGGGAGGGGG - Intergenic
1098455799 12:70672048-70672070 CAGAGATGGAGAATGGTGGAAGG + Intronic
1098460770 12:70730846-70730868 GAGAGCAGAAGGAAGGAGGAAGG + Intronic
1098460799 12:70731050-70731072 CAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098504852 12:71237605-71237627 AAGAGGAGGAGGAGGGTGGATGG - Intronic
1098558957 12:71851174-71851196 TAGAGCAGGAGGAAGGGGGAGGG + Intronic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099413347 12:82358810-82358832 CAGAGTGGGAAGCAGGTGGGTGG + Exonic
1099638167 12:85243762-85243784 AAAAGTAGGAAGAAGGTGGGAGG + Intronic
1099990238 12:89713745-89713767 CAGAGCAGGAGGAAGGAGAGAGG + Intergenic
1100299930 12:93297445-93297467 GAGAGTAGGAGGAGGATGGAAGG + Intergenic
1100341586 12:93684465-93684487 CAGAGCAGGAGGTAAGTGGCAGG - Intronic
1100721025 12:97358357-97358379 CAGAATTTGAGGAAGGTGAAGGG - Intergenic
1100813533 12:98363521-98363543 CAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1101519453 12:105467974-105467996 CAGAGGAGCAGGGAGGTGGTAGG + Intergenic
1101585739 12:106083984-106084006 GAGAGAAAGAGGAAGGAGGAGGG + Intronic
1101685905 12:107020574-107020596 CAGAGCAGGAGGAAGAGAGAAGG - Intronic
1101698122 12:107146018-107146040 GAGAAGAGGTGGAAGGTGGAGGG - Intergenic
1102114988 12:110396134-110396156 CACAGCAGGAGGTGGGTGGAGGG - Intronic
1102167804 12:110820587-110820609 GAGAGGAGGAGGGAGGGGGAAGG - Intergenic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1102647749 12:114414692-114414714 CACAGGTGGAGGAGGGTGGAGGG - Intergenic
1102886518 12:116526111-116526133 CAGAGAAGGAGAAAGGAAGAAGG - Intergenic
1103133886 12:118491157-118491179 CAGGGTTGGAGGAGGGTGGGTGG + Intergenic
1103247659 12:119471946-119471968 GAGAGAGGGAGGAAGGTGGGAGG - Intronic
1103375585 12:120453051-120453073 TAAAGTAGGAGGAAGGGAGAAGG + Intronic
1103844545 12:123892311-123892333 CAGAGTGGGAGCAAGGTTGGGGG + Intronic
1103896676 12:124277899-124277921 CAGAAGAGGAGGAAGAGGGAAGG - Intronic
1103963906 12:124626181-124626203 CAGAGGAGGAGGAGTGTGGAGGG - Intergenic
1104103862 12:125640529-125640551 CAGAGAAGGAGGCAGGTCCAGGG + Intronic
1104316227 12:127704394-127704416 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1104463629 12:128973573-128973595 TAGAGCAGGAGGAAGTTGGAGGG - Intronic
1104538085 12:129637540-129637562 CAGACCAGGAGGAAGGGGGTGGG - Intronic
1104629892 12:130391485-130391507 TAGAGTAGGAGGAAAAGGGACGG - Intergenic
1104748037 12:131221992-131222014 CAGGGCTGGGGGAAGGTGGAGGG + Intergenic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1105665591 13:22552368-22552390 CAGAGTAGGACTATGGTGGGGGG + Intergenic
1107105222 13:36636070-36636092 CAGAGTAGGAGCAAGAGAGAAGG + Intergenic
1107127123 13:36857714-36857736 CAAAGTAGAAGGAAGGTGCAGGG + Intronic
1107531571 13:41287299-41287321 CAGAGCAGGAGTAAGGAGGATGG + Intergenic
1108279698 13:48849298-48849320 CAGAGAAAGAGAGAGGTGGAAGG + Intergenic
1108346436 13:49551160-49551182 GGGAGAAGGAGGAAGGGGGAAGG + Intronic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1109044789 13:57395694-57395716 CAGAGTAGAAGCAATGTAGAGGG - Intergenic
1109091054 13:58046537-58046559 CTGAGTATTAGGAATGTGGAGGG + Intergenic
1109242131 13:59902329-59902351 CAGAGAAGGAGTAAGGTGGGAGG - Intronic
1109617521 13:64854988-64855010 CAGAGTAGGCGGAAGAGAGAGGG - Intergenic
1110477016 13:75928068-75928090 CATAGCAGGAGGTAAGTGGAGGG + Intergenic
1111442814 13:88303359-88303381 CAGAGCAGAAGGAAGTGGGAAGG - Intergenic
1111541439 13:89672284-89672306 CAGAGTGGGAGTGGGGTGGATGG - Intergenic
1111711500 13:91820476-91820498 CAGAGTAGTGGGATGGTGGTGGG - Intronic
1112018916 13:95354594-95354616 CAGAGCAGGTAGAATGTGGAAGG - Intergenic
1112052912 13:95662104-95662126 CAGAGCAGGAGGAATAGGGAGGG - Intergenic
1112105095 13:96231499-96231521 CAGAGCAGGAGGAAGGCGGGAGG + Intronic
1112169539 13:96956326-96956348 CAGAGCAGGAGGAAGAAAGAAGG + Intergenic
1112401679 13:99084204-99084226 CAGAGTACCAGGAAGGAGGTGGG + Intronic
1112734641 13:102402329-102402351 AAGAGTGAGAGGAAGGAGGAAGG - Intergenic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113179659 13:107610979-107611001 TAGATGAGTAGGAAGGTGGAAGG + Intronic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1114493666 14:23118615-23118637 CAGAGTTGGGGGCAGGTGCATGG + Exonic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115304141 14:31916617-31916639 GGAAGTAGGAGGCAGGTGGATGG - Intergenic
1116825360 14:49668285-49668307 AAGGGAAGGAGGAAGGGGGAAGG + Intronic
1116858672 14:49976229-49976251 TGGAGGAGCAGGAAGGTGGAAGG + Intergenic
1116968777 14:51042887-51042909 CAGAGTAGAACGAAGGTTAAAGG - Intronic
1116982483 14:51186224-51186246 CACAGTAGGAGGCAAGTGGTGGG + Intergenic
1117294904 14:54370490-54370512 CACAGTAGGAAGGAGGTGGGGGG - Intergenic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1118125360 14:62896470-62896492 CATGGTAAGAGGAAGGTGAAAGG - Intronic
1118304716 14:64646019-64646041 GAGAGAAGGAGGGAGGTGAAAGG + Intergenic
1119266451 14:73265520-73265542 CAGAATAGGAGGAAGGGGAGAGG - Intronic
1119310234 14:73640187-73640209 TGGAGAAGGTGGAAGGTGGAAGG - Intergenic
1119464091 14:74840198-74840220 GGGACTAGGAGAAAGGTGGAGGG - Intronic
1119729665 14:76943009-76943031 CAGAGCAGTTGGAAGGTGGGAGG - Intergenic
1119996833 14:79262445-79262467 AAGAGGAGGAGGAAGGAGGAAGG + Intronic
1120249084 14:82040255-82040277 CAGTGTAGGAGCAATGGGGAGGG - Intergenic
1120387242 14:83862101-83862123 CAGATTAGAAGGCAGGAGGAGGG - Intergenic
1120470516 14:84918057-84918079 AGGAGGAGGAGGAAGGAGGAGGG - Intergenic
1120895417 14:89527054-89527076 GAGAGGAGGAGGAAGGGGAAGGG + Intronic
1121173150 14:91871004-91871026 CAGGGTGGGAGGCAGGAGGAGGG + Intronic
1121246477 14:92464600-92464622 GACAGTAGCAGGAAGGTGGTCGG + Intronic
1122030736 14:98909654-98909676 CAGAGCAGGAGGCAGATGCATGG - Intergenic
1122056575 14:99102468-99102490 CAGAGCAGGAGGAAGAGGGAGGG - Intergenic
1122079032 14:99254233-99254255 TAGAGAAGTAGGAAGGTAGAGGG - Intronic
1122446395 14:101772843-101772865 GAGAATGGGAGGAAGGTGAAGGG - Intronic
1122832053 14:104403181-104403203 CAGAGAAGGAGGAAGGGTGGGGG - Intergenic
1122937313 14:104966226-104966248 CGGAGCAGTAGGAAGGTGGCGGG - Intronic
1123709259 15:22974907-22974929 CAGAAGTGGAGGGAGGTGGAAGG - Intronic
1123760003 15:23424662-23424684 CAGTCCAGGAGGAAGGTGCAGGG + Intergenic
1123827924 15:24101692-24101714 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123842383 15:24261103-24261125 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123857412 15:24427162-24427184 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123862043 15:24477694-24477716 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1124104977 15:26729348-26729370 CCAAGGAGGGGGAAGGTGGAGGG - Intronic
1124108980 15:26769759-26769781 CAGAGAGGGAGGGAGGAGGAGGG - Intronic
1124492344 15:30165757-30165779 CAGAGCAGGAGGAAGAGGCAGGG - Intergenic
1124711610 15:32017168-32017190 CAAAATAGGAGGAAACTGGAAGG + Intergenic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1124751192 15:32372560-32372582 CAGAGCAGGAGGAAGAGGCAGGG + Intergenic
1124805729 15:32880519-32880541 CAGTGGAGAAGGAAGGTGAATGG - Intronic
1125153157 15:36556539-36556561 CACTTTAGGAGGCAGGTGGATGG + Intergenic
1126653696 15:50953480-50953502 CAGAGCAGGATGAAGCAGGATGG - Intronic
1126657642 15:50996478-50996500 CAGAGTTGGAAGAAGGTGTTGGG + Intronic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127282269 15:57502408-57502430 CAGATATGGGGGAAGGTGGAAGG + Intronic
1127483165 15:59395836-59395858 CTGACTAGGAGAAAGGGGGAGGG - Intronic
1127507542 15:59610856-59610878 GAGGGAAGGAGGAAGGGGGAGGG - Intronic
1127695319 15:61441220-61441242 CAGAGCAGGAGGTAGGAGAAGGG - Intergenic
1127831628 15:62756113-62756135 GAGAGTAGGTGGAAGGAGAAGGG + Intronic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128254210 15:66185213-66185235 CAGGGTGGGAGGAGGGTGCAGGG - Intronic
1128478060 15:68014155-68014177 CAGAGTAGGGGGATGTGGGAAGG - Intergenic
1128539777 15:68518499-68518521 GAGAGTAGGGAGAAGGTAGAAGG - Intergenic
1128593133 15:68920456-68920478 CAGAGTAAGAGTAAGGAGTAAGG + Intronic
1129083090 15:73058797-73058819 CAGAGTAAGAGAAACCTGGAAGG - Intronic
1129191270 15:73939073-73939095 CAGTGTAGGAGTAAGGAGGCTGG - Intronic
1130271294 15:82450304-82450326 TAGAGAAGGAAGAAAGTGGAGGG + Intergenic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130489040 15:84417143-84417165 TAGAGAAGGAAGAAAGTGGAGGG - Intergenic
1130532227 15:84756198-84756220 CATACTAGGGGCAAGGTGGAGGG + Intronic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1130788159 15:87123245-87123267 AGGAGAGGGAGGAAGGTGGACGG - Intergenic
1130814598 15:87418058-87418080 CAGAGAAGTAGGAAGGTTTATGG + Intergenic
1131067961 15:89446099-89446121 CAGGGCTGGAGGAAGGGGGAAGG + Intergenic
1131174436 15:90201253-90201275 CCGGGAAGGAGGAAGGGGGAAGG + Intronic
1131185243 15:90268336-90268358 GAGATAAGTAGGAAGGTGGAAGG - Intronic
1131284696 15:91047719-91047741 CACAGGAGGAGGGAGGAGGAAGG - Intergenic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131296662 15:91155235-91155257 CAGGGGAGGAAGAAGGTGTAAGG + Intronic
1131364135 15:91823441-91823463 CAGAGCAGGAGCAAGGTGGGTGG - Intergenic
1131510659 15:93047932-93047954 GAGAGTCGCAGGAAGGTGGAAGG + Intronic
1131615863 15:94016823-94016845 CCGAGGTGGAGGAGGGTGGAAGG + Intergenic
1131789558 15:95949266-95949288 CAGAGAAGGAGGCAAGAGGAGGG + Intergenic
1131826065 15:96323126-96323148 CAGAGTAGGAGAAAGGCCGACGG - Intergenic
1131846584 15:96495352-96495374 CAGAGAAGGAGGAGGGTGGAAGG + Intergenic
1132299548 15:100767521-100767543 CAGAGAAGGAGGAAAGAGAAGGG + Intergenic
1132515384 16:363565-363587 CAGAGCAGCAGGATAGTGGAGGG - Intergenic
1132752752 16:1466313-1466335 CCGAGCCTGAGGAAGGTGGAGGG - Intronic
1132861961 16:2076247-2076269 CAGAGTGACAGGCAGGTGGAGGG + Intronic
1133214636 16:4284229-4284251 CAAAGCAGGAGGCAGGAGGATGG + Intergenic
1133582615 16:7160827-7160849 AGGAGGAGGAGGAAGGAGGAGGG - Intronic
1133599682 16:7326877-7326899 AAAAGTGTGAGGAAGGTGGAGGG - Intronic
1133692790 16:8232738-8232760 CAGAGGCAGAGGAAGGTGGGTGG - Intergenic
1133850636 16:9500144-9500166 GAGAGTAGGAAGCAGCTGGAAGG - Intergenic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134449319 16:14354008-14354030 GAGGGAAGGAGGAAGGGGGAGGG + Intergenic
1134449397 16:14354219-14354241 GGGAGGAGGAGGAAGGGGGAGGG + Intergenic
1134456337 16:14398218-14398240 CAGTCCAGGAGGAAGGTGCAGGG - Intergenic
1134464799 16:14465734-14465756 CAAAGTTGGAGGAAGGCTGAGGG + Intronic
1134632233 16:15765130-15765152 GATGGTAGGTGGAAGGTGGATGG + Intronic
1134655826 16:15947948-15947970 GAGGGAAGGAGGAAGGAGGAAGG - Intergenic
1134690571 16:16188709-16188731 CAGAGTGGGAGGGAGAGGGATGG - Intronic
1135020378 16:18957937-18957959 CAGACTAGGAGGAAAGTTGGAGG - Intergenic
1135082246 16:19446083-19446105 AAGAGTTGGGGGGAGGTGGAGGG + Intronic
1135218557 16:20593557-20593579 CTCAGAAGGAGGAAGGTGGGAGG - Intergenic
1135526114 16:23214935-23214957 CAGAGTAAGAGGAAACAGGAAGG + Intronic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1135986051 16:27185130-27185152 CAGAGCAGGAGGAAGCGGCAGGG + Intergenic
1136548367 16:30967909-30967931 CAAACTAGGAGGAAGGTGGTAGG - Intronic
1137296233 16:47096886-47096908 ACGAGTAGGAGCAGGGTGGAGGG + Intronic
1137622345 16:49884172-49884194 CAGAGGAGGAGGACGCTGGTTGG + Intergenic
1137767280 16:50987669-50987691 CAGACTAGGAGGATGGCAGAAGG - Intergenic
1137827304 16:51510160-51510182 CAAAGGAGAAGGAAGATGGATGG - Intergenic
1137931302 16:52590036-52590058 CAGAGAAGGAGGGAAGAGGAAGG + Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138084259 16:54119431-54119453 CAGAGTTGGGGGCAGGGGGAAGG - Exonic
1138093339 16:54194123-54194145 CAGAGTAGGAGGGAGGGAGTGGG - Intergenic
1139375745 16:66495371-66495393 CAGGGTGGGAGGGAGGTGGGAGG - Intronic
1139425061 16:66874053-66874075 TAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1139631422 16:68234168-68234190 GAGGGTAGGAGGAAGGAGGCAGG + Intronic
1140205917 16:72933319-72933341 CAGAGGAGTAGGAAGGTGGAGGG + Intronic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140449450 16:75058706-75058728 CAGACTAGGTGGAGGGTAGATGG + Intronic
1140558137 16:75945219-75945241 CAGACCAGGAGCAAGTTGGAGGG - Intergenic
1140749469 16:78010166-78010188 CAGGCTAGGAGGAAGATGGCAGG - Intergenic
1141155196 16:81592504-81592526 CACCGCAGGAGGAAGGAGGAGGG - Intronic
1141372476 16:83500559-83500581 AAGAGGAGGAGGGAGGAGGAGGG - Intronic
1141424890 16:83938446-83938468 CAGAGGAGGTGGAAAATGGATGG + Intronic
1141427140 16:83951880-83951902 GAGAGAAGGAGGAAGGAGGAAGG - Intronic
1141773194 16:86103850-86103872 CATAATAGAAGCAAGGTGGAGGG - Intergenic
1141817317 16:86421094-86421116 CAGAGTAGGAGGAAGAGAGAGGG + Intergenic
1141877947 16:86839025-86839047 CCGGGCAGGAGGAAGGAGGAAGG + Intergenic
1142032340 16:87844783-87844805 CAGAGTGGTTGGAAGGCGGAAGG - Intronic
1142251465 16:88993827-88993849 GGGAGGAGGAGGAAGGAGGAGGG - Intergenic
1142994110 17:3750903-3750925 GAGAGGAGGAGGAAGCTGGGTGG + Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143565044 17:7716097-7716119 CAGAGGTGGAGGTAGGGGGAAGG - Intergenic
1143714769 17:8758866-8758888 GAGAGAGGGAGGAAGGTGGAAGG + Intergenic
1144027591 17:11292277-11292299 CAGAGTAGGGGGAAAGGGGAGGG - Intronic
1144121438 17:12157764-12157786 CAGAGCAAGAGCAAGGTGTAGGG - Intergenic
1144178551 17:12731316-12731338 CAGAGTAGGAGGAGTGTGGGTGG - Intronic
1145306666 17:21679273-21679295 CAAAGTAGGAGGGAGGCAGAGGG - Intergenic
1145819076 17:27817416-27817438 CAGGGTAGGAGAGAGGCGGAGGG + Intronic
1146018155 17:29249965-29249987 CAGAGTAGGGATGAGGTGGAGGG - Intronic
1146178138 17:30679670-30679692 CAGAGGAGCAGGAAGGAGGGGGG + Intergenic
1146593835 17:34152837-34152859 TAGAGTGGAAGGAAGGAGGAGGG - Intronic
1146624622 17:34425821-34425843 TAAAGTAGGAGGAAGGGGTAGGG - Intergenic
1146626476 17:34439064-34439086 AAGAGAAGGAGAGAGGTGGAAGG + Intergenic
1147403234 17:40193276-40193298 CAGAGTGGGAGAATGGCGGAGGG + Intronic
1147602294 17:41754168-41754190 CAGAGTAGGTGGTGGGGGGAAGG + Intergenic
1147635377 17:41960726-41960748 CACAGTGGGAGGGAGGTGGGGGG + Intronic
1147782361 17:42952758-42952780 CAGAGGAAGAGGAAAATGGACGG + Intronic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148350277 17:46936508-46936530 CAGGGTGTGAGGCAGGTGGAGGG - Intronic
1148399223 17:47339551-47339573 CACAGTAGGAGGTAAGTGGCTGG - Intronic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148661670 17:49338980-49339002 GAGAGGAGGAGGCTGGTGGAAGG - Intronic
1148844978 17:50524546-50524568 CAGATTAGGAAGAAGGGGCAGGG - Intronic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149107079 17:52982584-52982606 GGGAGAAGGAGGAAGGGGGAAGG - Intergenic
1149620514 17:58041303-58041325 CAGATTATGAGGGATGTGGATGG - Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149891264 17:60392152-60392174 CGGAGTAGGAGGCAGGGGAAGGG - Intronic
1150316735 17:64175266-64175288 CAGATCAGGAGGCGGGTGGAGGG + Intronic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150956926 17:69869451-69869473 GAGGGTAGGAGGAAAGGGGAGGG + Intergenic
1151053564 17:71006588-71006610 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
1151241681 17:72763166-72763188 GAGAAGGGGAGGAAGGTGGAGGG - Intronic
1151302506 17:73237783-73237805 CAAAGTAGGATGCAGGTGGTAGG + Intronic
1151355367 17:73555009-73555031 CAGGCTGGGAGGAAGGAGGATGG + Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151446715 17:74170969-74170991 CTGGGAAGGAGGAATGTGGATGG + Intergenic
1151454557 17:74218213-74218235 CAAGGGAGGAGGAAGGAGGAGGG - Intronic
1151553852 17:74836841-74836863 CAGACTGGGTGGAAGGTGGGTGG - Exonic
1151577861 17:74961989-74962011 CCTTGTAGGAGGAAGGGGGAGGG + Exonic
1151720824 17:75855079-75855101 CGGGGTTGGAGGAAGGTGGGTGG - Intronic
1151829438 17:76540918-76540940 CAGAGGAGGAGGAGGGGGAAGGG - Intronic
1152000071 17:77639872-77639894 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1152000082 17:77639908-77639930 AAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1152037275 17:77881123-77881145 CAGGATAGGAGGATGGAGGATGG + Intergenic
1152077360 17:78168098-78168120 CAGACCAGGAGGAATGGGGAGGG + Intergenic
1152617111 17:81343071-81343093 CAGGAGTGGAGGAAGGTGGAAGG - Intergenic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1153060658 18:991569-991591 CAGGGAAGGAGGAAGAAGGAAGG - Intergenic
1153092704 18:1366582-1366604 GAGAGAAGGAGGAAGAGGGATGG - Intergenic
1153343748 18:4004374-4004396 GAGAGCAGGAGGAAGGCAGAGGG - Intronic
1153446197 18:5175328-5175350 CTGAGTTGTAGGTAGGTGGAAGG + Intronic
1153793880 18:8604969-8604991 GAGAGGCGGAGGCAGGTGGATGG + Intergenic
1154136674 18:11785868-11785890 GGGAGTGGGAGGAAGGTGGGCGG - Intronic
1154492373 18:14931998-14932020 CAGAGCAGGAGGGAGGTGGGAGG - Intergenic
1155066589 18:22273915-22273937 AAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1155766283 18:29637262-29637284 CAGATCAGAAGGAAGGTGAATGG - Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156154576 18:34286983-34287005 GAGAGCAGGAGCAAGGTGTAGGG + Intergenic
1156242732 18:35268994-35269016 CTGAATAGGAGGAAAGTGGAGGG + Intronic
1156507588 18:37608133-37608155 CAGAGCCAGAGGACGGTGGAGGG + Intergenic
1156783461 18:40880732-40880754 CAGAGAAGGAGGTGGGGGGAGGG - Intergenic
1156961297 18:43034901-43034923 CAGAGGAGGAGGAAGGTGAGAGG - Intronic
1157490796 18:48122420-48122442 TAGGGTATGAGGGAGGTGGAGGG + Intronic
1157549393 18:48570798-48570820 CAGACTTTGAGGAGGGTGGAGGG + Intronic
1157625205 18:49045173-49045195 GGGAGGAGGAGGACGGTGGAAGG + Intronic
1157673051 18:49546928-49546950 CAGAGTAGGAGCAAGAGAGAGGG + Intergenic
1157952232 18:52052596-52052618 CAGAGATGAAGGTAGGTGGAGGG + Intergenic
1159038322 18:63298585-63298607 CAGAGAAGGACAAAGGTGGAAGG + Intronic
1159223358 18:65495741-65495763 CAGAGTAGGATGGAGGTATAGGG + Intergenic
1159569692 18:70098784-70098806 TGGGGTAGGAGGAGGGTGGAGGG - Intronic
1159618424 18:70609113-70609135 CACAGTAGGAGCAAGGCTGAAGG + Intergenic
1159814035 18:73051790-73051812 GTGATTAGGAGCAAGGTGGAAGG - Intergenic
1159900375 18:74039483-74039505 AGGAGCAGGAGGAAGGGGGAGGG - Intergenic
1160019922 18:75172495-75172517 GAGAGTAGGAGGAAGGAAGCGGG + Intergenic
1160178645 18:76615895-76615917 CAGGGAAGGTGGAAGGGGGATGG + Intergenic
1160210110 18:76870799-76870821 CTGAGAAGCAGGAAGGTGGCTGG + Intronic
1160335241 18:78032862-78032884 AAGAGGAGGAGGAAGGGGGTAGG - Intergenic
1160345762 18:78130560-78130582 CAGAGGAGGAGTGAGGTGGGAGG + Intergenic
1161010380 19:1956980-1957002 GAGAGAAGGAGGGAGGAGGAGGG + Intronic
1161020847 19:2010742-2010764 CAGAGTCTGAGGCAGGAGGATGG - Intronic
1161266341 19:3366467-3366489 GAGAGCAGGAGGGAGGAGGAGGG + Intronic
1161644677 19:5445726-5445748 CAGAGGAGGAGGGAGGAGGGAGG + Intergenic
1161785667 19:6324005-6324027 CAGAGTCGGAAGGGGGTGGAGGG - Intronic
1162424775 19:10588005-10588027 CAGAGGAGAAAGAAGGTGAATGG - Intergenic
1162836800 19:13325053-13325075 AAGAGGAGGAGGAAGGGGAAGGG - Intronic
1163036052 19:14569617-14569639 GGCAGTGGGAGGAAGGTGGACGG + Intronic
1163204904 19:15795212-15795234 CAGAGAAGAAGGAAGGGGGAGGG - Intergenic
1163389345 19:17020944-17020966 CAGAGTCCCAGGAAGGTGGATGG - Intronic
1163465799 19:17467960-17467982 CAGAGCACAAGAAAGGTGGAGGG + Intergenic
1164188312 19:22892760-22892782 AAGAGGAGGAGGAGGGGGGAGGG - Intergenic
1164234900 19:23323369-23323391 GAGAGTAGGAGGAAGAGGAAGGG - Intronic
1164249665 19:23465922-23465944 CAGAGGAGGAGGAGAGGGGAAGG - Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1164757347 19:30700055-30700077 GAGAGAAGGAGGGAGGCGGAGGG - Intronic
1164871438 19:31647580-31647602 CAGAGCAGGAGGAAGAGGGTGGG + Intergenic
1165062798 19:33212988-33213010 CAGAGCAGCAGAAAGCTGGAAGG + Exonic
1165327471 19:35122746-35122768 CAGTCTAGGAGGAAAGTGGAGGG - Exonic
1165528906 19:36379879-36379901 CAGAGTGGGAGAAAGGGAGAGGG - Intergenic
1165566975 19:36738843-36738865 CAGAGTAGAAGGATGGTTAATGG + Intronic
1165690890 19:37862389-37862411 AGGAGGAGGAGGAAGGAGGAGGG + Intergenic
1165699911 19:37929662-37929684 AAGGGTAGGAGGAGGGGGGAGGG - Intronic
1165922014 19:39305226-39305248 CGGAGCAGGAGGGAGGGGGATGG - Intergenic
1166033503 19:40150538-40150560 CAGAGCAGGAGGAAGAGAGATGG - Intergenic
1166317542 19:41997557-41997579 CAGAGTGGGCGGGAGGGGGATGG - Intergenic
1166328889 19:42067511-42067533 CAGAGTGGGAGGAGTGTGAAGGG + Intronic
1166795259 19:45421955-45421977 GACATTAGGAGGAAGGAGGATGG - Intronic
1166824427 19:45600375-45600397 AAGAGAGGGAGGGAGGTGGAGGG - Intronic
1167074412 19:47240003-47240025 CAGGGGAGCAGGGAGGTGGATGG - Intergenic
1167130475 19:47582107-47582129 GAGAGAAGGAGGGAGGTGGAAGG - Intergenic
1167148067 19:47694468-47694490 CAGAGGAGGTGGAGGATGGAGGG - Exonic
1167608166 19:50492792-50492814 AAGAGGAGGAGGAAAGAGGAAGG + Intergenic
1167608202 19:50492906-50492928 GAAAGGAGGAGGAAGGAGGAGGG + Intergenic
1167634956 19:50649048-50649070 GAGAGAAGGAGGGAGGAGGAGGG + Intronic
1167641494 19:50685100-50685122 CAGAGAAGAAGGAAGCGGGAAGG + Intronic
1167867091 19:52337178-52337200 CAGAGTAGGGGAGAGGAGGAGGG + Intronic
1168143916 19:54408581-54408603 AAGAGAGGGAGGAAGGAGGAAGG + Intergenic
1168289774 19:55351959-55351981 GGGAGGAGGAGGAAGGAGGAAGG + Intronic
1168498728 19:56875686-56875708 CTGAGTAGGAGTAAGGAGGGAGG + Intergenic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
924971880 2:135898-135920 CAGAGCAGGAGGAAGGGAGGAGG - Intergenic
925301242 2:2814267-2814289 CAGAGCAGGATGAAGGGTGAGGG - Intergenic
925498170 2:4475956-4475978 CAGAGTTGGAGGTTGATGGATGG - Intergenic
925659142 2:6184071-6184093 AAGAGAAGGAGGGAGGAGGATGG + Intergenic
925732927 2:6935091-6935113 CAGAGAAGAAGGAAGAGGGATGG - Intronic
925820399 2:7794194-7794216 CAGAGCAGGAGAAAGGGAGATGG - Intergenic
926385926 2:12335790-12335812 CAGAAAAGGAGGAAAGTGAAGGG - Intergenic
926757589 2:16248840-16248862 CAGAGAAGCTGGAAGTTGGAAGG + Intergenic
926913728 2:17874379-17874401 CAGAGTATGAGCAATCTGGAAGG + Intergenic
927014895 2:18949556-18949578 TGGAGCAGGAGGAAGGTGGCAGG - Intergenic
927573356 2:24179714-24179736 CAGGGCAGGAGGAAGGGGTAAGG + Intronic
927842240 2:26453151-26453173 AAGAGTGGGAAGAAGGGGGATGG - Intronic
928093096 2:28388253-28388275 CAGAGAAGGAGGTAGGAGGTGGG + Intergenic
928106739 2:28475414-28475436 TGGAGAAGGAGGAAGGTGGTGGG - Intronic
928619845 2:33077504-33077526 CAGAGCAGGAGGAAGAGAGAGGG + Intronic
928790504 2:34946157-34946179 GGGAGTAGGAGCAAGCTGGAGGG - Intergenic
928956526 2:36875182-36875204 CCAAGTAGTAGAAAGGTGGAAGG + Intronic
928958660 2:36898858-36898880 AGGAGTAGGAGGAAGAAGGAAGG + Intronic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929588066 2:43128330-43128352 CAGAGTAGGGGCATGGAGGAAGG + Intergenic
929607099 2:43241958-43241980 GAGAGTTGGAGGGAGGGGGAAGG - Intronic
929642577 2:43596339-43596361 CAGAGTGGGAGAAAGGTGGAAGG - Intergenic
929706783 2:44221546-44221568 CAGAAGAGGAGAAAGTTGGAAGG + Intronic
929916618 2:46142141-46142163 CAGTGGAGGTGGAAGGTGGTAGG - Intronic
930084059 2:47480214-47480236 AAGGGAAGGAGGAAGGGGGAAGG - Intronic
930084067 2:47480233-47480255 AAGGGAAGGAGGAAGGGGGAAGG - Intronic
930140348 2:47945163-47945185 CAGAGTAGGAAGGGTGTGGAAGG - Intergenic
930260579 2:49141439-49141461 CAGAGCAGGAGCAAGGTAGTGGG + Intronic
931090459 2:58880549-58880571 CAGGGAAGGAGGAAGGAAGAAGG + Intergenic
931331327 2:61287543-61287565 AAGAGGAGGAGGAAGGTGAGGGG - Intronic
931966135 2:67536862-67536884 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
932049605 2:68385551-68385573 AAGAGGAGGAGGGAGGTGAAGGG - Intronic
932357403 2:71077818-71077840 AAGAGTTCAAGGAAGGTGGATGG - Intronic
933811670 2:86036507-86036529 CAGAGAGGAAGGAAGGGGGAGGG + Intronic
933850721 2:86364549-86364571 CAGAGCAGGAGCAAGGGGGTGGG + Intergenic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934920852 2:98344219-98344241 GAGAGTGGGAGGAAGGGGGTGGG - Intronic
934991444 2:98924700-98924722 AGGAGTAGGAGGAAGGAGGTGGG - Intronic
935023145 2:99251101-99251123 GAGAGTAAGAGGAAGGTAAAGGG + Intronic
935096758 2:99952251-99952273 CAGAGCAGGAGGAAGGGGTTTGG - Intronic
935111035 2:100094548-100094570 CAGAGTGGGAGGTGAGTGGATGG - Intronic
935618951 2:105112268-105112290 GAGGGAAGGAGGAATGTGGAGGG + Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935676381 2:105598090-105598112 CAGAGTGGGAGGCAGGCAGAGGG - Intergenic
935798863 2:106672160-106672182 CAAAGCAGGAGGAAGGTGTTGGG - Intergenic
936123942 2:109770614-109770636 CAGAGTGGGAGGTGAGTGGAGGG + Intergenic
936220747 2:110600850-110600872 CAGAGTGGGAGGTGAGTGGAGGG - Intergenic
936343075 2:111654840-111654862 CAGTGTGGGAGGAAGGTGTCAGG - Intergenic
936379390 2:111970698-111970720 GGGAGGAGGAGGGAGGTGGAAGG - Intronic
936600193 2:113888513-113888535 GAGAATGAGAGGAAGGTGGAAGG - Intergenic
936616543 2:114053695-114053717 CAAATTAGAAGGAATGTGGACGG - Intergenic
936658225 2:114513009-114513031 AAGAAAAGGAGGAAGGGGGAGGG + Intronic
937307328 2:120880452-120880474 CGGGGAAGGAGGAAGGAGGATGG - Intronic
937747239 2:125429304-125429326 GAAATGAGGAGGAAGGTGGAAGG - Intergenic
937872986 2:126799006-126799028 CAGCCAAGGAGGAAAGTGGAAGG - Intergenic
938128859 2:128693815-128693837 CAGAGTCGGAGGAAGGTGCCAGG + Intergenic
939227064 2:139377676-139377698 CAAAGTAGGAGGAAGAAGGTGGG - Intergenic
939384452 2:141477465-141477487 CAAATTAGGAGGAAGGCTGAGGG + Intronic
939552352 2:143630973-143630995 CAGAGCAGGTGGAAAGGGGAAGG - Intronic
939680785 2:145129515-145129537 CAGAGGTGGAGGAGGTTGGAGGG - Intergenic
939727951 2:145746589-145746611 CAAAGAAGGAGGAAGGAAGAGGG + Intergenic
940985939 2:160052346-160052368 CAGAGCAGGAGGACAGAGGAGGG - Intronic
941256556 2:163239530-163239552 CAGAGGAGGAGGAAAAAGGAAGG + Intergenic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941428631 2:165383901-165383923 GAGAGTGAGAGGAAGGAGGAAGG + Intronic
942407018 2:175667027-175667049 CAGTGTAGGAGGAGGTTGGGGGG - Intergenic
942450746 2:176106874-176106896 AAGAGGGGGAGGAAGGGGGAAGG - Intronic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
943556904 2:189416561-189416583 TGGGGTAGGAGGAAGGGGGAGGG + Intergenic
943577002 2:189641638-189641660 CAGAGATGGAGTAAGGTGAATGG + Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
945109895 2:206352453-206352475 GAGAGGAGGAGGAAGGGGAAGGG - Intergenic
945533966 2:210989014-210989036 CAGAGTTGGAAGAGTGTGGAGGG + Intergenic
946040273 2:216776861-216776883 GAGAGAAGGAGGGAGCTGGATGG - Intergenic
946281210 2:218666833-218666855 CAGAATAGAATGAAGGTGGGTGG - Intronic
946882583 2:224191391-224191413 CACAGTAGGGTGAGGGTGGAAGG - Intergenic
947270881 2:228333563-228333585 TAGAATAGGAGCAAGGTGCAGGG - Intergenic
947373764 2:229474789-229474811 CTGAGAAGGAGCAAGGTGGTGGG - Intronic
948041567 2:234905625-234905647 GAGAGAAGGAGGGAGGAGGAAGG + Intergenic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948233218 2:236366794-236366816 GAGAGGAGGAGGAAGGAGGGAGG - Intronic
948379363 2:237542041-237542063 GAGAGTGTGAGGAGGGTGGACGG + Intronic
948383098 2:237564465-237564487 CACAGGTGGAGGAAGGAGGAGGG + Intergenic
948458427 2:238117979-238118001 AATAGATGGAGGAAGGTGGATGG + Intronic
1169082732 20:2807091-2807113 CAGAGTGGTGGGAAGGGGGATGG - Intergenic
1169662696 20:7997989-7998011 CAGAGTAGGAGCAAGAGAGAAGG - Intronic
1169852782 20:10070678-10070700 CAGAGTAGGAAGAAGAGAGAGGG + Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170100733 20:12696532-12696554 CAGATTAGGAGGAATGGGCATGG + Intergenic
1170756782 20:19212436-19212458 CAGAGGAGGAGGAGCGGGGAAGG - Intergenic
1170883706 20:20319537-20319559 CAGAGCAGGAGGAAGAGAGAAGG - Intronic
1172382433 20:34506449-34506471 CACAGCAGGAGGTAAGTGGAGGG + Intronic
1172536923 20:35681037-35681059 CAGAGAGGGAGGAAGGGGGAAGG - Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1173002048 20:39111647-39111669 AAGGGGAGGAGGAAGGGGGAGGG + Intergenic
1173140558 20:40478271-40478293 CAGAGTGGGAGAATGGTGGTGGG - Intergenic
1173159131 20:40639403-40639425 AAGAGTTGGAGGAAGGGGGAGGG - Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173203592 20:40972802-40972824 CAGAGTAGAAGGATGGTTAATGG - Intergenic
1173280298 20:41620927-41620949 GAGAGCAAGAGGAAGATGGAAGG + Intergenic
1173369709 20:42424447-42424469 GAGAGTGGGAGGCAGGTGGAAGG - Intronic
1173517643 20:43676255-43676277 GAGGGTGGGAGGAGGGTGGAGGG - Intronic
1173571394 20:44078976-44078998 AGGAGTAAGAGGAAGCTGGAAGG - Intergenic
1173575958 20:44113100-44113122 CAGGGTGGGAGGAAGGGGGATGG + Exonic
1173621975 20:44443645-44443667 CAGAATAGGAGGAAGTGGGTTGG + Intergenic
1173837906 20:46137876-46137898 CAGAGTAGGAGAAAGGAGCATGG - Intergenic
1174112463 20:48205895-48205917 CAGAGAAGGAGGGAGGAGGAGGG - Intergenic
1174168773 20:48603624-48603646 CAGAGAAGGAGGGAGGAGGAGGG + Intergenic
1174216517 20:48920736-48920758 AAGAGTAGGAGAAAGGGTGAAGG - Intergenic
1174853931 20:54024685-54024707 AAGAGTACCAGGGAGGTGGAAGG + Intronic
1175452060 20:59077759-59077781 GAGAGGAGGAGGAAGGAGAAAGG + Intergenic
1175461416 20:59154475-59154497 CAGGATGGGAGGAAAGTGGAAGG - Intergenic
1175603382 20:60293064-60293086 CAGAGTAGGGGGCAGCTGTAGGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175757400 20:61538488-61538510 CAGAGTAGGAGGAGAGAGGAGGG - Intronic
1175763339 20:61576011-61576033 CTGAGTAGGAGGAAAAGGGAGGG + Intronic
1175889746 20:62310872-62310894 CCGAGAAGAAGGAAGGTGGTGGG - Intronic
1176411867 21:6453557-6453579 CGGGGTAGGAGGAAGGTGAGCGG + Intergenic
1176674026 21:9760504-9760526 GAAAGTAGGAGGAAGGAGGGGGG - Intergenic
1176674038 21:9760573-9760595 GAAAGTAGGAGGAAGGAGGGGGG - Intergenic
1176674051 21:9760642-9760664 CTTAGTAGGAGGAAGGAGGGGGG - Intergenic
1176723814 21:10413945-10413967 TAGAGTAGTAGAAAGGTGGCAGG + Intergenic
1177159899 21:17536502-17536524 CAGAGTAGAGGGAAAGTGAAAGG - Intronic
1177197364 21:17917510-17917532 GAGAGTAACAAGAAGGTGGAAGG + Intronic
1177294970 21:19162211-19162233 CAGAGCAGGAGGAAGAGAGATGG + Intergenic
1177722532 21:24927030-24927052 CAGAGTAGGAGCAAGAGAGAGGG - Intergenic
1178600248 21:33988387-33988409 TGGAGCAGGAGGAAGGTGCAGGG + Intergenic
1178729395 21:35085711-35085733 CAGAGCAGGAGAAAGATAGAGGG - Intronic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179073757 21:38098693-38098715 GGGAGTAGGAGGCAGGGGGAAGG - Intronic
1179095692 21:38312623-38312645 CTGATTAGAAGGAAGGTTGAAGG - Intergenic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179396307 21:41043489-41043511 CAGAGCAGAAGGAAGGTGGTGGG + Intergenic
1179687361 21:43061879-43061901 CGGGGTAGGAGGAAGGTGAGCGG + Intronic
1180304961 22:11066686-11066708 TAGAGTAGTAGAAAGGTGGCAGG + Intergenic
1180581489 22:16843360-16843382 AGGAGTAGGAGGAAGAAGGAAGG + Intergenic
1180891970 22:19295566-19295588 CAGAGTCTGAGGCAGGAGGATGG + Intergenic
1181118586 22:20650155-20650177 CAGAGTAGCAGGAAGAAGCAGGG + Intergenic
1181508451 22:23377591-23377613 AAGAGGAGGAGGAAGGGAGAAGG + Intergenic
1181527879 22:23500487-23500509 GGGAGGAGAAGGAAGGTGGAGGG + Intergenic
1181775950 22:25160378-25160400 AAGAGTAACAGGGAGGTGGAGGG - Intronic
1181886083 22:26023504-26023526 AAGAGGAGGAGGGAGGAGGAGGG - Intronic
1181931337 22:26403943-26403965 AGGAGGAGGAGGAAGGAGGAAGG + Intergenic
1182082445 22:27538892-27538914 CAGGGAAGGAGGAAGGGGGAGGG - Intergenic
1182848090 22:33447799-33447821 GAGAGTGGGTGGAAGGAGGAAGG + Intronic
1183259429 22:36784945-36784967 CAGGGTTGGAGGTAGGAGGAAGG - Intergenic
1183463826 22:37968926-37968948 CAGGCTTGGAGGAGGGTGGATGG - Exonic
1184206792 22:43009664-43009686 CAGAGGGGGAGGAGCGTGGATGG - Intronic
1184306209 22:43604016-43604038 CAGAGCAGGATGAAGGTGGTGGG - Intronic
1184612448 22:45613397-45613419 AAGGGGAGGAGGATGGTGGACGG - Intergenic
1184758272 22:46529461-46529483 GGTAGCAGGAGGAAGGTGGATGG + Intronic
1184988046 22:48148838-48148860 CAGAGTGGGGGGCAGGGGGAAGG - Intergenic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
949576186 3:5341075-5341097 GAGAATAGGAGGAAAGCGGATGG - Intergenic
950039702 3:9912041-9912063 CACAGCAGGAGGTAAGTGGAGGG + Intronic
950130052 3:10536459-10536481 AGGAGGAGGAGGAAGGAGGAAGG - Intronic
950201648 3:11048628-11048650 CATGGTAGGAGGCAGTTGGAGGG - Intergenic
950290382 3:11779323-11779345 GAGAGGAGGAGGAAGGTGCCAGG + Intergenic
950946209 3:16949658-16949680 CAAAGTGGGAGGAGGATGGAGGG - Intronic
951519749 3:23600247-23600269 CAGAGTAATGGGAAGGTGTAAGG - Intergenic
951607538 3:24452599-24452621 CTGGGTTGGAGGAAAGTGGAAGG - Intronic
951667471 3:25143276-25143298 CAGTGTAGGATGAAGAGGGAAGG + Intergenic
952580373 3:34825430-34825452 CAGGGAAGGAGGGAGATGGAGGG + Intergenic
953056942 3:39395605-39395627 CAGATTATGAGGGAGGAGGAAGG + Intronic
953154889 3:40360779-40360801 CAGAGAAGGAAAAAGGTGGTGGG - Intergenic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
954217753 3:49133795-49133817 GAGAGAAGGAGGAAAGTGGGTGG + Intergenic
954361583 3:50125324-50125346 CAGAGTGGGAGGTCCGTGGAAGG + Intergenic
954752187 3:52819913-52819935 CAAAGTAGGAGGTGGGGGGAGGG - Exonic
955395889 3:58556909-58556931 CAGGGAAGGAGGAAGGGGGAAGG + Intergenic
955396005 3:58557945-58557967 CAGATAAGGGGGAGGGTGGAGGG + Intergenic
956004206 3:64761692-64761714 CAGAATAGGAAGATGGTGGTGGG + Intergenic
956084735 3:65597507-65597529 CAGGCTGGGAGGAAGGGGGAGGG - Intronic
956451430 3:69378873-69378895 ACAAGTAGGAGGAAGGTAGAAGG - Intronic
957287077 3:78230765-78230787 CAGAGGAGAAGGAGGATGGAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957951619 3:87134925-87134947 GAGAATAGGAGAAAGATGGAGGG - Intergenic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
958886069 3:99728383-99728405 CATGGTAGGAGGAAGCAGGAAGG - Intronic
959034440 3:101344530-101344552 GAGAGTAGGAAAAAGGTAGAGGG + Intronic
959080388 3:101794699-101794721 TAGAGAAGGAGGAAGGTAAAGGG + Intronic
959110218 3:102114186-102114208 CAGAGTAGCTGGAAGGTCAAGGG - Intronic
959321902 3:104887177-104887199 CATAGCAGGAGGAGGGTGGATGG + Intergenic
959583028 3:108001383-108001405 GAGAGCAGGAGGCAGGTAGAGGG - Intergenic
959933074 3:112003357-112003379 CAGAGAAGCAGGAAGAGGGAGGG + Intronic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960734546 3:120764170-120764192 CAGGGAAGGAAGAAGGTGAAGGG - Intronic
961104638 3:124230618-124230640 CTGAGTAGGACGAAGGGGGCTGG + Intronic
961347991 3:126277191-126277213 CAGAGCAGGAGGAAGAGGGGTGG + Intergenic
961425935 3:126847819-126847841 CAGAGTAGAAGGCAGGTGAGAGG - Intronic
961624604 3:128253221-128253243 CAGAGTTGTAGGAACGTGCATGG - Intronic
961777093 3:129295758-129295780 CAGGGGTGGAGGGAGGTGGAGGG - Intronic
962282322 3:134061278-134061300 CAGAGTGTGAGGAAGGACGAGGG + Intergenic
962395272 3:135010284-135010306 CAGAGTAGGGGGATGAGGGAAGG - Intronic
962887785 3:139643434-139643456 CACAGTAGCCAGAAGGTGGAAGG + Intronic
963223663 3:142838435-142838457 CAGAGTAGAAGCAAGGTCGAGGG - Intronic
963480353 3:145865467-145865489 CAGAAGAGGAGAAAGGGGGAGGG + Intergenic
963825810 3:149952008-149952030 AAAAGTAGGAGTAGGGTGGAGGG - Intronic
964023648 3:152044990-152045012 AAGAGAAAGAGGAAGGTAGATGG + Intergenic
964507171 3:157412050-157412072 CAGAGCAGGAGGAAGAGAGAGGG - Intronic
965213164 3:165822717-165822739 AAGAGTAGAAAGAAGCTGGAGGG + Intronic
965597258 3:170421188-170421210 CAAAGTATGAGGGAGGGGGAAGG - Intronic
966186482 3:177231620-177231642 GAGAGTTGGAGAAAGGGGGAAGG - Intergenic
966521913 3:180882416-180882438 AGGAGAAGGAGGAAGGAGGAAGG - Intronic
966891184 3:184408817-184408839 CAGAGTAGGAGACAGGAGGCAGG - Intronic
966929532 3:184666869-184666891 CAGAGAAGGAGGCTGGAGGAGGG + Intronic
967056873 3:185836821-185836843 CAGAATAGAAGGAATGGGGAGGG - Intergenic
967576827 3:191104483-191104505 CAGAGTAGGAGGAAGAGTCAGGG + Intergenic
967679533 3:192344290-192344312 CATAGTAGGAGGAACATGGCTGG + Intronic
967762715 3:193242794-193242816 CAGTGTAGGAGGATTATGGATGG + Intronic
967870866 3:194227857-194227879 CAGAAAAGGAGGAAGTTGGCAGG - Intergenic
968518682 4:1025393-1025415 CAGACTGGGAGGATGGAGGACGG + Exonic
968789928 4:2652551-2652573 TGGAGTAGGAGGAAGGGGGGTGG + Intronic
968914191 4:3490029-3490051 ATGAGTAGGAGGAAGAAGGAAGG - Intronic
969146569 4:5129348-5129370 CAGAGCTTGAGGAAGGTGGAGGG - Intronic
969262255 4:6041435-6041457 AGGAGAAGGAGGAAGGTGGAAGG - Intronic
969387779 4:6867312-6867334 CAGAGTAGAAGGACGGAGGCAGG + Intronic
969493140 4:7511285-7511307 GAGAGAAGGAGGGAGATGGATGG + Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969860799 4:10033957-10033979 CAGAGTAGGAGAAAAGGGGCTGG - Intronic
969922849 4:10557257-10557279 TAGAGAAGGGTGAAGGTGGAGGG - Intronic
971845268 4:31910983-31911005 CAGAGGTGGAGAAAGGTAGAGGG - Intergenic
972103139 4:35447468-35447490 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103215 4:35447771-35447793 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103228 4:35447818-35447840 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
972770534 4:42193209-42193231 CAGGAGAGGAGGAAAGTGGAAGG - Intergenic
973752267 4:54033008-54033030 CAGAGCAGGAGCAAGGGGGTTGG - Intronic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975007914 4:69313486-69313508 CAGAGTAGGAGGAAGGTGGAGGG - Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975411597 4:74058425-74058447 GAGAGGAGGAGGGAGTTGGAGGG - Intergenic
975504451 4:75122856-75122878 AAGAGGAGGAGGAAGGAGGAAGG + Intergenic
975835638 4:78419827-78419849 CAGAGCAGGAGGAAAGCGGGTGG + Intronic
975845807 4:78524080-78524102 CAGAGTAGGAACCAGGAGGAGGG - Intronic
976338527 4:83919007-83919029 AAGAGTATGAGGCATGTGGAAGG + Intergenic
976805424 4:89040929-89040951 CAGAATGGGAGAGAGGTGGAGGG - Intronic
977066551 4:92323700-92323722 CAGAGAAGAAGAAAGGAGGAAGG - Intronic
977238283 4:94535315-94535337 AAGAGCAAGAGGAAGGTGAAAGG - Intronic
977279077 4:95016623-95016645 AAGAGAAGGAGAAAGATGGAAGG + Intronic
977445473 4:97126060-97126082 CAGGGTGGGAGCAAGGTGGAAGG - Intergenic
978268546 4:106859013-106859035 AAGAGGAGGAGGAAGGGGAAAGG + Intergenic
978894726 4:113873145-113873167 AAAAGTAGGAGGAAAGAGGAAGG - Intergenic
979086546 4:116417730-116417752 CAGAGTAGGAGGTAGGAGGAGGG + Intergenic
979350347 4:119637097-119637119 CAGAGCAGGAGGTAAGTGGCAGG - Intergenic
979906561 4:126300738-126300760 CAGAGTAGGAGGGAGGTGCTGGG + Intergenic
979915723 4:126431197-126431219 TGGAGTAGGAGGAAGGAGGCGGG + Intergenic
980848139 4:138348781-138348803 CACAGAAGGAGGAAGGTGGGAGG + Intergenic
981106898 4:140891768-140891790 CACAGCAGGAGGTGGGTGGAGGG + Intronic
981941497 4:150286410-150286432 CAAAGGATGAGGAAGGAGGAAGG - Intronic
982195670 4:152910287-152910309 CAGAGTTGGGGGAAGTGGGAGGG + Exonic
982227020 4:153175561-153175583 AATAGCAGGAGGAAGGCGGATGG + Intronic
982868459 4:160546694-160546716 GAGAGGAGGAGGAAGGCAGATGG - Intergenic
983487988 4:168353832-168353854 CAGGGTAGGGGAAATGTGGATGG + Intergenic
983759151 4:171384248-171384270 CTCAGCAGGAGGGAGGTGGATGG - Intergenic
984113965 4:175655102-175655124 CAGAGTAGAAAGAAGATGTAAGG - Intronic
984214292 4:176889423-176889445 CAGAGGAGGAGGAAGAGAGAAGG + Intergenic
984217318 4:176930630-176930652 CAGTGTTGGGGGAAGCTGGATGG + Intergenic
984501525 4:180565148-180565170 CAGGGTATGAGGAAGTGGGAGGG - Intergenic
984951402 4:185010549-185010571 AAGAGGAGGAGGGAGGTGAAAGG - Intergenic
985062919 4:186096088-186096110 CAGAGCTGGAGGAGGCTGGAGGG - Intergenic
985402539 4:189606726-189606748 GGGAGAAGGAGGAAGATGGAGGG - Intergenic
985533096 5:445177-445199 CCGAGGAGGACGATGGTGGAGGG + Intronic
985707968 5:1412524-1412546 CAGACTCGGATGGAGGTGGAGGG + Intronic
985783091 5:1881106-1881128 TGGAGTAGGAGGAAGTTGGAGGG + Intronic
985972645 5:3390641-3390663 CAGAGTCTGACGAAGGTGCAGGG + Intergenic
985972651 5:3390686-3390708 CAGAGTCTGACGAAGGTGCAGGG + Intergenic
985972657 5:3390731-3390753 CAGAGTCTGACGAAGGTGCAGGG + Intergenic
986613877 5:9597109-9597131 CAGAGGAGGAGGAAGGGGAAGGG - Intergenic
987141466 5:14951177-14951199 CAGAGCAGGAGGTAAATGGAAGG + Intergenic
988608775 5:32705540-32705562 TAGAGCAGGAGGAAGAGGGATGG + Intronic
988616269 5:32778022-32778044 CAGAGTTGGGGGATGCTGGAGGG + Intronic
989154910 5:38335393-38335415 AAGAGTAGTGGGAAGTTGGATGG - Intronic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989741606 5:44779846-44779868 CAGAGGACTAGGAAGCTGGATGG + Intergenic
990294265 5:54384418-54384440 CAGAGTAGGATGGAGGTGTGAGG + Intergenic
990679339 5:58223441-58223463 CAGAGCAGGAGGAAGGTCAGGGG - Intergenic
991145015 5:63291172-63291194 CAGAGTAGCAGGAAAGAAGAGGG - Intergenic
991333519 5:65520215-65520237 CAGAGTGGGAGCAAGAGGGAGGG - Intronic
991501520 5:67281999-67282021 CGGAGAAGGGGGAAGGGGGAAGG - Intergenic
991506470 5:67328996-67329018 CAAAGTTGGAGGCAGGTGGAGGG + Intergenic
992341189 5:75825078-75825100 TAGAGTAGGCGGAAAGAGGAGGG + Intergenic
992357195 5:75998191-75998213 CGGGGTGGGAGGAAGGGGGAGGG + Intergenic
992605165 5:78448084-78448106 TGGAGTAGGGGGAAGGGGGAGGG - Intronic
993741807 5:91550603-91550625 GAGAGTAGAAGCAAGGTGGTGGG + Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
994709972 5:103255331-103255353 CTGAGGAGGAGAAAGGTGGAAGG - Intergenic
994819823 5:104634912-104634934 CACAGTAGGAGGTAAGTGGCAGG - Intergenic
995246103 5:109937342-109937364 CAGAGAAGGAGAAAGAGGGAAGG + Intergenic
995255139 5:110037204-110037226 CCCAGAAGGAGTAAGGTGGAGGG - Intergenic
995261415 5:110108273-110108295 CAGAGCAGGTGGCAGTTGGAGGG + Intergenic
995367191 5:111375874-111375896 CAAAATAGGAAGAAGATGGAAGG + Intronic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
996238895 5:121170519-121170541 CAGAGCAGGAGGAAGTGGCAGGG + Intergenic
996339214 5:122417710-122417732 GAGGGAAGGAGGAAGGGGGAAGG - Intronic
996960991 5:129249432-129249454 CAGGGTAGGAGGCAAGGGGACGG + Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998537669 5:142949696-142949718 CAGAGTGGGAGGGAGGTAGCTGG + Intronic
999182940 5:149682834-149682856 CAGAGCAGGAGGGAGGCTGAGGG + Intergenic
999243431 5:150140483-150140505 CAGAATAGGAGGAATCAGGAGGG - Intronic
999423415 5:151465047-151465069 AAGAGTAGGAGGGAAGAGGAAGG - Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999889372 5:155960141-155960163 AAGAGGAGAAGGAAGATGGAAGG - Intronic
1000204887 5:159049404-159049426 CAGAGAAGTAGGATGGTGGAGGG + Intronic
1000996453 5:167964065-167964087 TAGGCTGGGAGGAAGGTGGAGGG - Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001471533 5:172016842-172016864 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
1001829578 5:174774218-174774240 CAGAGAAGGTGGAAGCAGGAAGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002127648 5:177058726-177058748 GAGAGCTGGAGGCAGGTGGAAGG - Intronic
1002189101 5:177469662-177469684 GGGAGGAGGAGGAAGGAGGAAGG - Intronic
1002322102 5:178382415-178382437 CAGAGGAGGAGGAGGGCGAAGGG - Intronic
1002527876 5:179824982-179825004 CAGAGTGGGAGGAAGGAGAGGGG + Intronic
1002918228 6:1546161-1546183 CAGAGCAGGAGGAAGAAGGAGGG + Intergenic
1002974855 6:2064604-2064626 CAGAGTGGGATGAAGGGGCATGG - Intronic
1003315855 6:5011357-5011379 CACAGCAGGAGGAAGGAGGAAGG + Intergenic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1003923487 6:10855634-10855656 CGGAGTGGGAGGGAGGTTGAGGG - Intronic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1004649345 6:17593562-17593584 AAGAGAAGGAGGAAGGGGGAGGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005290687 6:24375843-24375865 GAGAGTAAGAGGAAGAAGGAAGG + Intergenic
1005391932 6:25342855-25342877 TGGAGGAGGAGGAAGGTAGAAGG - Intronic
1005466108 6:26115650-26115672 CAGAGTAAGAGCATGTTGGAGGG - Intronic
1005624611 6:27651625-27651647 CAGAGAAGGAGGGAGGGAGAGGG + Intergenic
1006088903 6:31616252-31616274 CACAGTGGGAGGAAGGAGAATGG + Intronic
1006110520 6:31741904-31741926 CAGAGAAGAAGCAAGGGGGAGGG + Intronic
1006272549 6:32975138-32975160 CAGAGTGGGTGGGAGGTGGGTGG + Intronic
1006357211 6:33566983-33567005 GAGAGGAGGAGAGAGGTGGAAGG + Intergenic
1006514367 6:34537899-34537921 CAGAATGGGAGGCAGGGGGATGG + Exonic
1006589736 6:35145725-35145747 AAGAGTAGGAGAAGGGTTGAGGG + Intronic
1006602778 6:35236992-35237014 CAGAGTAGGAGGAGTGTCGATGG - Intronic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1007359090 6:41342529-41342551 GAGAGAAGGAGAAAGGTAGAGGG - Intronic
1007737544 6:43990945-43990967 CACCATAGGAGGAGGGTGGAGGG + Intergenic
1007764439 6:44152514-44152536 CAGGGAAGGAGGGAGGGGGAAGG - Intronic
1007840510 6:44712344-44712366 CCCTGTAGGAGGATGGTGGAAGG - Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008543392 6:52564973-52564995 CAGAGAAGCATGAAGGAGGAGGG + Intronic
1009473200 6:64054469-64054491 TAGAGGAGGATAAAGGTGGAAGG + Intronic
1009798180 6:68498835-68498857 CAATGGAGGAGGAAGGTGAAGGG - Intergenic
1009870996 6:69451867-69451889 CAGAGGAGGAGGAAGGCCGGGGG - Intergenic
1010232216 6:73545106-73545128 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1010466922 6:76178671-76178693 CAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1010911716 6:81566446-81566468 CAAAGATGGAGGAAGTTGGAGGG + Intronic
1011645671 6:89455684-89455706 CAGAGCAGGAGGAAGAGAGAGGG - Intronic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1012150761 6:95748415-95748437 CAGAGCAGGAGTAAGGGGAAAGG - Intergenic
1013013790 6:106143373-106143395 CAGAGTGGGAGGTAGGTGACAGG + Intergenic
1013272924 6:108559835-108559857 GGGAGGAGGAGGAATGTGGAAGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1013620147 6:111879941-111879963 CAGGGTAGGAGGGAGTTGGGGGG + Intergenic
1013764871 6:113563038-113563060 CAGAGAAGGATGAAGGTGGCAGG - Intergenic
1014040914 6:116823845-116823867 CAGATTAGGAGGAAGAAAGAGGG + Intronic
1014510975 6:122321976-122321998 AAGAGGGGGAGGAAGGTGAAAGG + Intergenic
1014558051 6:122856821-122856843 CACAGCAGGAGCAAGGTGGTGGG + Intergenic
1014700883 6:124686445-124686467 CAGAGCAGGAGGAAAGGGGAGGG + Intronic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1016631710 6:146240654-146240676 CAGAGCAGGATGAAGAAGGATGG + Intronic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017258912 6:152364664-152364686 GAGGGAAGGAGGAAGGAGGAAGG + Intronic
1017665259 6:156713756-156713778 CAAAGGAGGAGGGAGGAGGAAGG + Intergenic
1017869846 6:158478098-158478120 GAGAGTGGGAGGAGGGAGGAGGG + Intronic
1018150003 6:160928794-160928816 CAGAGGACGAGGAAGGTAGTTGG - Intergenic
1018276332 6:162135711-162135733 CAGAGAAGGTAGAAGGTGAAAGG + Intronic
1018425235 6:163673943-163673965 CAGAGCAGGAGGAAGAGCGAGGG + Intergenic
1018480060 6:164181146-164181168 CACAGTGGCAGGAAGATGGAAGG - Intergenic
1018564566 6:165137619-165137641 CAGAGCAAGAGGAAGGAGTAGGG - Intergenic
1019334881 7:478383-478405 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019334974 7:478677-478699 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019334980 7:478695-478717 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019334986 7:478713-478735 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019334992 7:478731-478753 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335002 7:478760-478782 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335022 7:478816-478838 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335028 7:478834-478856 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335038 7:478863-478885 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335054 7:478908-478930 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335060 7:478926-478948 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335080 7:478982-479004 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335086 7:479000-479022 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335096 7:479029-479051 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335116 7:479085-479107 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335122 7:479103-479125 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335132 7:479132-479154 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335148 7:479177-479199 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335154 7:479195-479217 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019335169 7:479237-479259 GAGGGAAGGAGGAAGGAGGAGGG + Intergenic
1019390529 7:784129-784151 CAGAGGTGCAGGCAGGTGGACGG - Intronic
1019861967 7:3667393-3667415 CAGGGTAGGAGGAGGTTGGGAGG - Intronic
1020047144 7:5048843-5048865 CAGAGCAGGAGGAAGAGGGAGGG + Intronic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1021037496 7:15818056-15818078 CAGAGTAGGAGAGAGTAGGATGG - Intergenic
1021183302 7:17533606-17533628 CAGAGTGGGAGGATGGGAGAAGG - Intergenic
1021654927 7:22865346-22865368 CAGCCCAGGAGGATGGTGGATGG - Intergenic
1021658395 7:22894617-22894639 CAGTGCAGGAGGAAGGTGGTTGG + Intergenic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1021776362 7:24058911-24058933 CATAGCATGAGGAAGATGGAGGG + Intergenic
1021795750 7:24252370-24252392 AAGAGTAGGAGGAAGAGAGAAGG - Intergenic
1022060431 7:26787682-26787704 CAGAGCAGGAGCAAGAGGGAGGG + Intronic
1022096161 7:27142878-27142900 AAGAAGAGGAGGAAGGAGGAAGG + Intronic
1022100036 7:27164094-27164116 GAGAGTGGGAGGAAGGAGAAGGG - Intronic
1022180297 7:27912558-27912580 CAGAGAGGGAGGAAGGAAGAGGG + Intronic
1022212496 7:28225250-28225272 CTGAATTGGAGGAAGGTTGAGGG + Intergenic
1022251023 7:28608564-28608586 GAGATTGGGAGGAGGGTGGAAGG - Intronic
1022389812 7:29933715-29933737 CATAGTAGGAGGAGGGAGGGAGG + Intronic
1022782153 7:33596833-33596855 AAGAATAGAAGGAAGGGGGATGG - Intronic
1022800520 7:33772636-33772658 CAGAGGAGGAGGAAGGGTGGAGG - Intergenic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1022844079 7:34192398-34192420 GAGAGAAGGAGGAAGTTTGAAGG - Intergenic
1023425838 7:40035378-40035400 CACAGTAGGAGGTGAGTGGAAGG + Intronic
1023457142 7:40352453-40352475 GAGAGTAGAGGGAAGGAGGAGGG - Intronic
1023548793 7:41346744-41346766 CAGGGTAGGAGGAAAAAGGAAGG - Intergenic
1023612656 7:41986928-41986950 GAGAATAGGAAGAAGGTTGAAGG + Intronic
1023708484 7:42967067-42967089 CAAAGGAGGAGGAAGGAAGAGGG - Intergenic
1024024826 7:45401196-45401218 CAGTGCAGGAGGATGGTGGAGGG + Intergenic
1024920037 7:54545872-54545894 CAGAGAAGGAGAAGGGTAGAGGG + Intronic
1025067645 7:55871596-55871618 GAGGGTAGGAGGTAGGAGGAGGG + Intergenic
1025198673 7:56949331-56949353 GGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1025673276 7:63627600-63627622 GGGAGGAGGAGGAAGGAGGAGGG + Intergenic
1025778865 7:64581896-64581918 AAGATTAGAAAGAAGGTGGAAGG + Intergenic
1026133148 7:67636817-67636839 AAGAGAGGGAGGAAGGGGGAGGG - Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026474904 7:70726893-70726915 AAGAGAATGAGGAAGGGGGATGG - Intronic
1026638776 7:72106565-72106587 GAGAAAAAGAGGAAGGTGGAAGG + Intronic
1026786658 7:73305898-73305920 AAGAGTAGGAGAAAGGGAGAGGG + Intronic
1026871034 7:73852030-73852052 AAGGGAAGGAGGAAGGGGGAAGG - Intergenic
1026941684 7:74290712-74290734 CAGAGGAGGAGGAGGGTGCGGGG + Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027758379 7:82246583-82246605 CAGAGTAGGGAGAATGTTGAAGG + Intronic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028505504 7:91566075-91566097 CGGTGTATGAGGAAAGTGGAAGG - Intergenic
1028792290 7:94866690-94866712 CAGAGCAGGAGGAAGAGAGAGGG - Intergenic
1028804757 7:95012293-95012315 CAGAATAGGAGGAACAGGGAGGG + Intronic
1029020215 7:97357234-97357256 AGGAGTGGGGGGAAGGTGGAAGG + Intergenic
1029037680 7:97539413-97539435 CTGCTTAGGAGGAAGATGGATGG + Intergenic
1029145000 7:98439578-98439600 GAGGGAAGGAGGAAGGAGGAGGG - Intergenic
1029423519 7:100483720-100483742 CAGATTCGGAGGAAGGTCGTGGG - Intergenic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1030380007 7:108800845-108800867 GAGAGGAGGAGGAAAGGGGAGGG - Intergenic
1031995528 7:128227899-128227921 CAGAAGAGCAGGAAGGGGGAGGG + Intergenic
1032065778 7:128769300-128769322 GAGAGGAGGAGGAATGGGGACGG - Exonic
1032464889 7:132137907-132137929 ATGAGTATGAGGATGGTGGAAGG + Intronic
1032610465 7:133407284-133407306 CAAAGTAAGAGGATGGTGGATGG - Intronic
1032669396 7:134069408-134069430 GAGAAGAGGAGGAAGGAGGAAGG - Intergenic
1033168132 7:139059152-139059174 CAGAGTAGGAGGATGGGGAGGGG - Intronic
1033337465 7:140465783-140465805 AAGAGTAAGAGGTAGGTGGCCGG + Intronic
1034447746 7:151122174-151122196 CCAGGGAGGAGGAAGGTGGATGG - Intronic
1034820862 7:154215156-154215178 CAGTGATGGCGGAAGGTGGAAGG + Intronic
1034861065 7:154595223-154595245 CAGAAAAGGAGGAAGCTGGCAGG - Intronic
1034978909 7:155463431-155463453 AGGAGCAGGAGGAAGGAGGAAGG - Exonic
1034991065 7:155548486-155548508 GAGATTAGGAGGAAGAGGGATGG + Intergenic
1035143323 7:156786226-156786248 AAGAGAAGGAGGAAGGAGGAAGG + Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035732058 8:1860318-1860340 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035732080 8:1860385-1860407 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037692458 8:21193769-21193791 AAGAGAAGGAGGAAGGTGAAAGG + Intergenic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1037930578 8:22877824-22877846 GGGAGTCGGAGGAGGGTGGAGGG + Intronic
1038165890 8:25084779-25084801 CATTGTAGGAGGAAAGAGGAAGG + Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038775310 8:30525354-30525376 CGGAGGAGGAGGAAGGAGAAGGG - Intronic
1039453427 8:37693648-37693670 CAGAGCAGGAGGCAGCTGAAAGG - Intergenic
1039480150 8:37867133-37867155 CACAGTAAAAGGAAGATGGATGG + Intronic
1039806188 8:41001730-41001752 AAGAGGAGGAGGAAGGAAGAAGG - Intergenic
1039845630 8:41323608-41323630 CAGGACAGGAGGGAGGTGGAGGG + Intergenic
1040383944 8:46900670-46900692 GAGACCAGGAGGAAGGTGGTGGG + Intergenic
1040546445 8:48401633-48401655 AGGGGTAGGAGGAAGGAGGAGGG + Intergenic
1040579781 8:48688369-48688391 CAGAGTAGTAGGCAGCAGGAGGG - Intergenic
1040772699 8:50998187-50998209 CATGGGTGGAGGAAGGTGGAAGG - Intergenic
1040874991 8:52141781-52141803 CAGAGTGGGAGGCTGGGGGATGG + Intronic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041347893 8:56920499-56920521 AAGAGGAGGAGGAAGAGGGAGGG + Intergenic
1041953516 8:63532047-63532069 CTGAGTTGGAGGAAGTTGTAGGG - Intergenic
1042130440 8:65582519-65582541 GGGAGGAGGAGGAAGGTGCAGGG + Intergenic
1042537082 8:69869996-69870018 GAGGGCAGGAGGAAGATGGAAGG - Intergenic
1042576041 8:70219671-70219693 AAGGGCAGGAGGAGGGTGGAGGG + Intronic
1043377678 8:79668733-79668755 CTCAGTAGGAGGAGGGTAGATGG - Intergenic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1044493550 8:92849283-92849305 CAGAGTCTGAGGAAGGAAGAAGG + Intergenic
1045321102 8:101081743-101081765 CAGTATAGGAAGATGGTGGAAGG + Intergenic
1045485976 8:102632102-102632124 AAGTGTAGGAGGAAGTTAGAAGG + Intergenic
1045932427 8:107642887-107642909 CACAGTAGGAGGTAGGTGGTGGG - Intergenic
1045987403 8:108264567-108264589 GAGAGCAGGAGGAAGGTGGCAGG - Intronic
1046611388 8:116429468-116429490 CACAGCAGGAGGAAGGTGAGTGG + Intergenic
1046696107 8:117341282-117341304 GAGGCTAGGAGGAAGGAGGAGGG + Intergenic
1046778528 8:118190195-118190217 CAGAGTATGAGAAGGGAGGATGG - Intronic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047426109 8:124748453-124748475 AAGAGCAGGAGGAAGGTGGGTGG + Intergenic
1047484953 8:125320968-125320990 CAGAGCAGGAGGAAGAGAGAGGG + Intronic
1047946783 8:129888222-129888244 CAGAGCAGGAGGAAGAGAGATGG - Intronic
1048080492 8:131121329-131121351 CAGAGAAGCAGCAAGGTGTAGGG + Intergenic
1048165925 8:132061379-132061401 GAGAGAAGGAGGAAGGGAGAGGG - Intronic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048427912 8:134339687-134339709 CAAAGTAGGAGGGTTGTGGAAGG - Intergenic
1048818307 8:138355001-138355023 TAGGGTGGGAGGAAGGGGGAGGG - Intronic
1049271081 8:141696643-141696665 CAGGCTGGAAGGAAGGTGGAGGG - Intergenic
1049286733 8:141779945-141779967 GGGAGTAGGAGGTAGGAGGATGG + Intergenic
1049306440 8:141906739-141906761 CGGAGCAGGTGGAAGGCGGAGGG - Intergenic
1049350542 8:142162139-142162161 CAAGGTGGGAGGAAGGGGGAAGG - Intergenic
1049759202 8:144324299-144324321 AAGAGCAGCAGGAAGCTGGAGGG + Intronic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050351197 9:4741874-4741896 CAGAGGAGGAGGAGGAAGGAGGG - Intronic
1050625772 9:7502375-7502397 CACAGATGCAGGAAGGTGGAAGG + Intergenic
1050886141 9:10768755-10768777 CAGAGTAGGGGGCAGGGAGATGG - Intergenic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051170381 9:14314698-14314720 AGGAGGAGGAGGAAGGTGGGGGG - Intronic
1051189118 9:14492559-14492581 CAGAGCAGGAAGAAGAGGGAGGG + Intergenic
1051877374 9:21806517-21806539 CAGAGTGGGTGGCAGGTTGAGGG + Intronic
1051892035 9:21952302-21952324 CAGAGCAGGAGGAAGAGAGAAGG + Intronic
1052074749 9:24127396-24127418 AAGTGGAGGAGGAACGTGGAGGG + Intergenic
1052578370 9:30319943-30319965 CAGAGAAGTAGAAAGGTGCAAGG - Intergenic
1052989181 9:34508686-34508708 CAGAGTAGGAGTAGGGTGGTTGG - Intronic
1053480545 9:38413430-38413452 GGGAGGAGGAGGAAGGAGGAGGG - Intronic
1054795944 9:69302143-69302165 CAGAGCAGTAGGAAGAAGGATGG - Intergenic
1054837444 9:69692725-69692747 CAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1054866952 9:70012733-70012755 CAGAGAAGGAGAAAGGGGGAGGG - Intergenic
1054897193 9:70327970-70327992 CAGAGTAGGAGAGAGGATGAGGG + Intronic
1055660069 9:78494385-78494407 GAAAGAAAGAGGAAGGTGGAAGG - Intergenic
1056795349 9:89655226-89655248 TTGAGTAGGAGGAAGCTGGAAGG - Intergenic
1057302293 9:93893955-93893977 CAGAGCGGGAGGGAGGTGGGAGG - Intergenic
1057307891 9:93922760-93922782 CAGAGAAGAAGGAAGAGGGAGGG + Intergenic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1058332292 9:103777944-103777966 CAGAGTAGGAGCAAGAGAGAAGG - Intergenic
1059927733 9:119228191-119228213 AAGATTAGGAGGAAGGGGAAAGG - Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060418839 9:123453002-123453024 AAAAGTGGGAGGAAGGAGGAGGG + Intronic
1060736780 9:126071186-126071208 CAGAGGAAGAGGTAGCTGGAAGG - Intergenic
1060777113 9:126382997-126383019 CAGAGTAGGAGATAGGTGCGTGG + Intronic
1061425480 9:130495702-130495724 TTGAGTAGGTGGGAGGTGGAAGG + Intronic
1061572691 9:131487536-131487558 GAGAGGAGGAGGAAGGAGCAAGG - Intronic
1061899935 9:133667785-133667807 CAGATTAGGACGAGGCTGGAAGG + Intronic
1062245941 9:135566093-135566115 TATAGGAGGAGGAAGGAGGATGG + Intronic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062607528 9:137354872-137354894 CAGAGGTGGAGGACGGTGAAGGG - Intronic
1185735848 X:2495652-2495674 CAAGGGAGGAGGAAGGAGGAAGG - Intronic
1185835916 X:3345997-3346019 AAGAGTAGGAGGAAAGAGGCGGG + Intronic
1185931370 X:4207023-4207045 CAGAGCAGGAGGAGGAAGGATGG + Intergenic
1185999480 X:4992525-4992547 CAGAGTACTAGGAAGATGTAAGG - Intergenic
1186059886 X:5693382-5693404 CAGTGGAGGAGCAAGCTGGAAGG - Intergenic
1186246663 X:7622628-7622650 GAGAGAAGGAGGGAGGAGGATGG - Intergenic
1186257238 X:7735827-7735849 CAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1186456218 X:9712112-9712134 AAGAGGAAGAGGCAGGTGGAAGG - Intronic
1186645023 X:11497543-11497565 GAGAGAAGGAGGGAGGGGGAAGG - Intronic
1186653892 X:11592150-11592172 CAGAGGAGGAAGATGGGGGAAGG + Intronic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187039897 X:15582708-15582730 AAGAGTAGTGGGAAGGTGGCAGG + Intronic
1187221331 X:17329010-17329032 GAGAGCAGGTGGAAAGTGGAAGG - Intergenic
1187685861 X:21815020-21815042 GAGAGTGAGATGAAGGTGGAGGG - Intergenic
1187715388 X:22097455-22097477 CAGAGCAGGAAGAAGGTGAAAGG + Intronic
1188137157 X:26504731-26504753 CAGAGGAGGAGGTAGGGGAATGG - Intergenic
1188348099 X:29093323-29093345 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
1188839733 X:35001601-35001623 CAGCGTAGGAGGAAGAGTGAAGG + Intergenic
1189234232 X:39475448-39475470 AAGAGTAGGAGGGAGTGGGATGG - Intergenic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189563343 X:42213799-42213821 CAGAACAGGAGGGAAGTGGAGGG + Intergenic
1189901463 X:45711240-45711262 GAGAGAGGGAGGAAGATGGAGGG - Intergenic
1190076720 X:47322416-47322438 CAGTGTGGGAGGGAGGAGGAGGG - Intergenic
1190248410 X:48705635-48705657 CAGAGGAGGAGGAAAGATGAAGG - Intronic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1190509660 X:51162594-51162616 CAGAGGAGGAGCAGGGAGGAAGG - Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1191965796 X:66756931-66756953 GAGAGTAGGAGGGAGGTGAAAGG + Intergenic
1192070958 X:67940936-67940958 CAGAGCAGGAGGAAGAGAGATGG + Intergenic
1192706794 X:73534477-73534499 CAAAGGAGGAGCAAGGTGGCAGG - Intergenic
1192941664 X:75919698-75919720 CAGAGTATGAGAAAGTTGCATGG + Intergenic
1193278506 X:79620467-79620489 CAGAGCAGGAGGTAGGCGGCAGG + Intergenic
1193547427 X:82846920-82846942 CAGAGCAGGAGGAAGTGGGAGGG - Intergenic
1193701951 X:84773841-84773863 CAGAGTCGGGGGAGGGGGGAGGG - Intergenic
1193802033 X:85947429-85947451 CAGAGCAGGAGCAAGATAGAGGG - Intronic
1194721626 X:97346981-97347003 CAGAGAAGGAAGAAGGTGATGGG - Intronic
1195235556 X:102894017-102894039 CAGAGTAAGAGGAATGCTGAGGG + Intergenic
1195252254 X:103060528-103060550 AAAAGTGGGAGGAAGGAGGAAGG + Intergenic
1195385882 X:104313283-104313305 CAAAGAGGGAGGAAGGTGAAGGG - Intergenic
1195477682 X:105304994-105305016 CAGAGCAGGAGGAAAGGGGGAGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196204390 X:112922794-112922816 CAGAGCAGGAGGAAGAAAGATGG + Intergenic
1196729195 X:118924061-118924083 GAGAGTAGAAGGATGGTGGCCGG - Intergenic
1197048497 X:122029372-122029394 GAGAGCAACAGGAAGGTGGAGGG + Intergenic
1197436510 X:126434845-126434867 TAGAGGAGGGGGAAGGAGGAAGG + Intergenic
1197665285 X:129216635-129216657 CAGGGTAGCAGGAAGGAGAAGGG + Intergenic
1197674398 X:129313968-129313990 GAGAGCAGGAGAAAGGTGGGGGG + Intergenic
1197792636 X:130270786-130270808 CAGAGGCAGAGGAAGTTGGATGG - Intergenic
1198054119 X:132976901-132976923 TAGAGTAGGAGCAAGGTGGGGGG + Intergenic
1198273789 X:135081570-135081592 GAGAGTAGGGTGAGGGTGGAGGG + Intergenic
1198585904 X:138122020-138122042 AAGGGTAGTTGGAAGGTGGAAGG - Intergenic
1198972818 X:142300518-142300540 CAGAGCAGGAGAAAGGAGAAAGG + Intergenic
1199038104 X:143077846-143077868 GAGAGCAGGAGCAAGGTGGGAGG + Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200247205 X:154532536-154532558 CAGAGAAGGAGCAGTGTGGAGGG - Intronic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic