ID: 975010110

View in Genome Browser
Species Human (GRCh38)
Location 4:69340272-69340294
Sequence CAGAGTAGGGGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975010099_975010110 15 Left 975010099 4:69340234-69340256 CCGAGAAGGTGAAGGGGAAGCCA 0: 1
1: 1
2: 7
3: 43
4: 316
Right 975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG No data
975010100_975010110 -5 Left 975010100 4:69340254-69340276 CCAATATGTCCTACTGACCAGAG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975010110 Original CRISPR CAGAGTAGGGGGAAGGTGGA GGG Intronic
No off target data available for this crispr