ID: 975013332

View in Genome Browser
Species Human (GRCh38)
Location 4:69380958-69380980
Sequence CTGGGCTTTCTGGGTTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 811
Summary {0: 1, 1: 0, 2: 35, 3: 219, 4: 556}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975013318_975013332 29 Left 975013318 4:69380906-69380928 CCCAACAGCGGTTGGTGTGTCCT 0: 1
1: 1
2: 131
3: 107
4: 133
Right 975013332 4:69380958-69380980 CTGGGCTTTCTGGGTTAAGTAGG 0: 1
1: 0
2: 35
3: 219
4: 556
975013325_975013332 9 Left 975013325 4:69380926-69380948 CCTGTCTAGAGGGGGGACTGAGT 0: 1
1: 1
2: 4
3: 149
4: 270
Right 975013332 4:69380958-69380980 CTGGGCTTTCTGGGTTAAGTAGG 0: 1
1: 0
2: 35
3: 219
4: 556
975013319_975013332 28 Left 975013319 4:69380907-69380929 CCAACAGCGGTTGGTGTGTCCTG 0: 1
1: 0
2: 128
3: 108
4: 113
Right 975013332 4:69380958-69380980 CTGGGCTTTCTGGGTTAAGTAGG 0: 1
1: 0
2: 35
3: 219
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975013332 Original CRISPR CTGGGCTTTCTGGGTTAAGT AGG Intronic
901093834 1:6662480-6662502 CTGGACTTCCTGGGTCAGGTGGG + Intronic
901825286 1:11857380-11857402 CAGGGCTTTGTGGTTTTAGTTGG + Intergenic
902891632 1:19448438-19448460 CTGGGCTTTGTGGATTAAGGCGG - Intronic
903374098 1:22854930-22854952 CTGGGCTTGCTGGGTTGAGTGGG - Intronic
904362124 1:29983014-29983036 CTGGACTTCCTGGGTTAAGTGGG - Intergenic
904363578 1:29995366-29995388 ATGGGATTGCTGGGTCAAGTGGG + Intergenic
905642653 1:39601972-39601994 CTGGACTTCCTGGGTGGAGTGGG - Intergenic
905977228 1:42185111-42185133 CTGGACTTTGTAGGTTAAGTAGG - Intronic
906766045 1:48435218-48435240 CTGGACTCCCTGGGTCAAGTGGG + Intronic
906767180 1:48444111-48444133 CTGGATTTCCTGGGTCAAGTGGG + Intronic
906891506 1:49720975-49720997 CTGGACTTCCTGGGTAAAGTGGG + Intronic
906988904 1:50716455-50716477 CTGGACTTCCTGGGTCGAGTGGG + Intronic
907793724 1:57693301-57693323 CTGGCCTTACTGGGTCAAGTGGG + Intronic
908848316 1:68347657-68347679 CTGGACTTCCTGGGCCAAGTGGG + Intergenic
908910396 1:69066205-69066227 ATGGGATTTCTGGGTCAAATGGG + Intergenic
909049242 1:70748496-70748518 CTGGGCTTTTTTGGGTCAGTAGG + Intergenic
909358977 1:74740879-74740901 CTGGACTTTCTGGGTCAAGTGGG - Intronic
909359655 1:74745606-74745628 CTGGACTTCCTGGGTCGAGTGGG - Intronic
909382501 1:75015343-75015365 CTGGGCTTTCTTTGATAGGTAGG + Intergenic
909446974 1:75758523-75758545 CTGGACTTCCTGGGTCGAGTGGG + Intronic
909535502 1:76731294-76731316 CCTGGCTTTCTGGCTTAAGTGGG - Intergenic
909747214 1:79112728-79112750 CTGGACTTTCTGGGTCAAGTGGG + Intergenic
910380469 1:86621621-86621643 CTGGGCTTCCTGGGTCAAGTAGG + Intergenic
910459214 1:87430893-87430915 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
911247856 1:95538637-95538659 CTGGACTTTCTGGGTCAAGTGGG - Intergenic
911298589 1:96147687-96147709 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
911299318 1:96153012-96153034 TTGGACTTTCTGGGTTGAGTGGG + Intergenic
911345381 1:96690702-96690724 CTGGACTTCCTGGGTAGAGTGGG + Intergenic
911379621 1:97096500-97096522 CTGGACTTCCTGGGTCCAGTGGG + Intronic
911751080 1:101498997-101499019 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
912082831 1:105958577-105958599 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
912244204 1:107943907-107943929 GTGGGCTTTTTGGGTTTTGTGGG - Intronic
912431751 1:109631681-109631703 CTGGGCTTCCTGGCCTGAGTGGG + Exonic
912551479 1:110488164-110488186 CAGGGCTTTCTGCCTTTAGTAGG - Intergenic
912631411 1:111249554-111249576 CTGGCCTTCCTGGGTTCTGTGGG - Intergenic
912675918 1:111680556-111680578 CTGGACTTCCTGGGTCGAGTGGG - Intronic
913097065 1:115528638-115528660 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
913297696 1:117337596-117337618 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
913378926 1:118186815-118186837 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
913383327 1:118232889-118232911 CTGGACTTCCTGGGTCGAGTAGG + Intergenic
913419319 1:118647695-118647717 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
914333069 1:146690381-146690403 CTGTGTTGTCTGGGTTATGTAGG + Intergenic
914793452 1:150899841-150899863 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
915045585 1:153011719-153011741 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
916124725 1:161559209-161559231 CTGGCTTTTATTGGTTAAGTGGG + Intergenic
916134616 1:161640557-161640579 CTGGCTTTTATTGGTTAAGTGGG + Intronic
916365736 1:164025398-164025420 CTGGACTTCCTGGGTGGAGTGGG - Intergenic
916572806 1:166041873-166041895 CTGGGCATTCAGGGATAAGCAGG + Intergenic
916670489 1:167014262-167014284 CTGGGGTTTCTGGTTCAAGATGG - Intronic
917025712 1:170639198-170639220 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
917279526 1:173367879-173367901 CTGGACTTGCTGGGTTGAGTGGG + Intergenic
917280640 1:173375439-173375461 CTGGATTTCCTGGGTCAAGTGGG + Intergenic
917676723 1:177325469-177325491 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
917840774 1:178975554-178975576 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
918024102 1:180726025-180726047 CTGGACTTCCTGGGTTGAGTGGG + Intronic
918842554 1:189560930-189560952 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
918939959 1:190980636-190980658 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
919205959 1:194422157-194422179 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
919220164 1:194617801-194617823 CTGGACTTTCTGGGTCGAGTAGG + Intergenic
919257371 1:195141564-195141586 CTGGACTTCCTGGGTTAAGTAGG + Intergenic
919506460 1:198404684-198404706 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
919558439 1:199091130-199091152 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
919785909 1:201258763-201258785 CTGAGCTTCCTGGGTAAAGGGGG - Intergenic
921354801 1:214276008-214276030 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
921588442 1:216975903-216975925 CTGAGCTTTGTGGGATAAGAAGG - Intronic
921712955 1:218391157-218391179 ATGGGCATTCTGGGCTAAGGTGG + Intronic
921765453 1:218967522-218967544 TTGGGCTTTATGGGCTAACTTGG + Intergenic
921938670 1:220817677-220817699 CTGGACTTCCTGGGTCTAGTGGG - Exonic
922340599 1:224652138-224652160 CTGGGATTTCTGGGTTTTGAGGG + Intronic
922668665 1:227492994-227493016 CTGCCTTTTCTGGGTAAAGTGGG - Intergenic
924505777 1:244682366-244682388 CTGGACTTCCTGGGTCAGGTGGG - Intronic
924646725 1:245884664-245884686 CAGGACTTTCTGGGTTGAGTGGG + Intronic
1063414620 10:5863358-5863380 CTGGACTTCCTGGGTCAAATGGG + Intronic
1063859439 10:10291765-10291787 CTGGACTCCCTGGGTTGAGTCGG - Intergenic
1063972902 10:11393747-11393769 CTGGGCTTCCTGGGTCGAGTAGG + Intergenic
1064219435 10:13427989-13428011 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1064588650 10:16865519-16865541 TTGGACTTCCTGGGTCAAGTGGG + Intronic
1064601851 10:17001550-17001572 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1064665616 10:17648171-17648193 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1064757714 10:18586977-18586999 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1065422872 10:25566412-25566434 CTGGGCTTCCTGGGTTGAGTAGG - Intronic
1066149605 10:32601552-32601574 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1066479350 10:35780422-35780444 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1067096838 10:43307189-43307211 CTGGACTTTCTGGGTCCAGCAGG - Intergenic
1067539321 10:47140296-47140318 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1067559428 10:47294621-47294643 CTGGACTTCCTGGGTCAAGGGGG - Intergenic
1067854659 10:49781828-49781850 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1068142491 10:53025850-53025872 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
1068151625 10:53139662-53139684 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
1068368498 10:56083655-56083677 CTGGACTTCCTGGGTTGGGTGGG - Intergenic
1068484890 10:57645117-57645139 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1068499943 10:57832381-57832403 CTGGACTTCCTAGGTCAAGTGGG + Intergenic
1068501242 10:57841577-57841599 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1068754355 10:60634398-60634420 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1069152732 10:64985329-64985351 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
1069358424 10:67614271-67614293 CTGGACTTCCTGGGTCAAGTAGG - Intronic
1069967836 10:72136193-72136215 CTGGACTTCCTGGGTTGAATGGG + Intronic
1070073160 10:73109201-73109223 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1070281774 10:75054747-75054769 CAGGGCTGTATGGATTAAGTTGG - Intronic
1070648714 10:78219592-78219614 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1070660245 10:78300553-78300575 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1070677754 10:78424067-78424089 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1071054223 10:81490540-81490562 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1071061769 10:81578413-81578435 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1071156415 10:82694303-82694325 CTGGACTTCCTGGGCTGAGTGGG - Intronic
1074265226 10:111895195-111895217 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1075146932 10:119890317-119890339 CTAGACTTCCTGGGTTGAGTAGG + Intronic
1075167009 10:120077665-120077687 CTGGGCTTTGTCGGTGACGTCGG + Intergenic
1075254075 10:120910467-120910489 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
1075283605 10:121163106-121163128 CTGGCCTTTCTAGTTTAAGAGGG + Intergenic
1075604177 10:123792500-123792522 CTGGGGCTTCTGGGTTAGGGTGG - Intronic
1076067395 10:127459683-127459705 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1076896544 10:133315869-133315891 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1076897654 10:133321405-133321427 CTGCACTTCCTGGGTTGAGTGGG - Intronic
1076998289 11:310126-310148 CTGGGCTTCCTGGGTCGAGTAGG - Intronic
1077587994 11:3469207-3469229 CTGGTTGTTCTGGGTTCAGTGGG - Intergenic
1079703401 11:23579855-23579877 CCTAGATTTCTGGGTTAAGTAGG + Intergenic
1079848942 11:25505051-25505073 CTGGGCTTTCTTCGGTTAGTAGG + Intergenic
1079913345 11:26338195-26338217 CTGGACTTCCTGGGTTGAGTGGG + Intronic
1080331960 11:31149260-31149282 CTGGACTTCCTGGGTCAAGAGGG + Intronic
1081121385 11:39270903-39270925 CTGGACTTGCTGGGTGGAGTGGG + Intergenic
1081145638 11:39560230-39560252 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1081181445 11:39990263-39990285 CTGGGCTTCCTGGGTCAAGTAGG + Intergenic
1081184795 11:40028998-40029020 GTGGGCTTCCTGGGTCGAGTAGG + Intergenic
1081536286 11:43998573-43998595 CTGGCATCTCTGGGTTCAGTGGG + Intergenic
1082241519 11:49876681-49876703 CAGGGCTTTCTGGGATAAACAGG - Intergenic
1082620900 11:55420508-55420530 TTGGGCTTCCTGGGTTGAGTAGG - Intergenic
1082949051 11:58790708-58790730 CTGGGCTTTCTGGGTCGAGTAGG - Intergenic
1084032233 11:66487783-66487805 CTGGGCCTTCTGGGTTGGCTGGG - Intronic
1084243690 11:67840845-67840867 CTGGTTGTTCTGGGTTCAGTGGG - Intergenic
1084437125 11:69149720-69149742 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1084552940 11:69859325-69859347 CTGGACTTTCTGGGTCGAGTGGG + Intergenic
1086442746 11:86845558-86845580 CTGGGCCTCTTGGGTTGAGTAGG + Intronic
1086443448 11:86850435-86850457 CTGGGCTTCCTGGGTTGAGTAGG + Intronic
1086844524 11:91731649-91731671 CTGGGCTTCCTGGGTTGAGTAGG - Intergenic
1087349290 11:97011018-97011040 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1087458645 11:98419959-98419981 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1087459343 11:98425100-98425122 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
1087874715 11:103342116-103342138 CTGGACTTCCTGGGTTGAGTGGG + Intronic
1087965659 11:104410909-104410931 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1088519138 11:110675763-110675785 CTGGGTTTTGAGGGATAAGTAGG - Intronic
1089299228 11:117488445-117488467 CAGGGCTTTTTGGGTGAAGGCGG + Intronic
1090404408 11:126468283-126468305 CTGGGCTGTCTGGGGACAGTGGG - Intronic
1090550628 11:127815948-127815970 CTGGGGTTTCTTTGTTAAGTTGG - Intergenic
1090605482 11:128419260-128419282 CTGGGCTTTCTGGGTAATGGTGG + Intergenic
1091127029 11:133109627-133109649 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1091256189 11:134188049-134188071 TTGGACTTCCTGGGTCAAGTGGG + Intronic
1091933583 12:4416949-4416971 CTGGGCTTCCTGGGTCCAGTGGG - Intergenic
1092646558 12:10580498-10580520 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1093072089 12:14716247-14716269 TTGGGCTTCCTGGGTCTAGTAGG - Intergenic
1093213288 12:16332983-16333005 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1093517746 12:20010430-20010452 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1093967418 12:25341853-25341875 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1094254952 12:28412879-28412901 CTGGACTTCCTGGGTCGAGTAGG - Intronic
1094319377 12:29169127-29169149 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1094320376 12:29175891-29175913 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1094400312 12:30056056-30056078 CTGGACTTCCTGGGTCGAGTAGG - Intergenic
1094597970 12:31882722-31882744 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1094732892 12:33199101-33199123 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1094776122 12:33730063-33730085 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1095569042 12:43661067-43661089 CTGAGCTTTCTGGGTAGACTTGG - Intergenic
1095597249 12:43972855-43972877 CTGGACTTCCTGGGTCAAGTGGG - Intronic
1095630384 12:44369764-44369786 CTAGACTTTCTGGTTCAAGTAGG - Intronic
1096371135 12:51069997-51070019 CTGGGTTTTCTGGGCTGAGATGG + Intronic
1096613528 12:52818644-52818666 CAGGGCTTTCTGGGTAAGGGAGG + Intergenic
1097183012 12:57181521-57181543 CTGGGTTTTCTAGGACAAGTAGG + Intronic
1097393629 12:59046294-59046316 CTGGGTTTTCTGTGTGATGTGGG + Intergenic
1097414279 12:59295372-59295394 CTGGACTTCCTGGGTCAAATGGG + Intergenic
1097520884 12:60669467-60669489 CTGGGCTTTTTGGGGTTGGTAGG + Intergenic
1098386580 12:69925697-69925719 CTGGACTCTCTGGGTTTGGTTGG + Intronic
1098734398 12:74080715-74080737 CTTGGCGTTCTGGGATTAGTTGG + Intergenic
1098957008 12:76697996-76698018 CTGGGCTTCCTGTGTCCAGTAGG - Intergenic
1099726161 12:86430875-86430897 CTTGATTTTCTAGGTTAAGTAGG + Intronic
1099797959 12:87422215-87422237 CTGGACTTCCTGAGTCAAGTGGG - Intergenic
1099971689 12:89506799-89506821 CGGGGCTTCCTGGGTCGAGTAGG + Intronic
1100050503 12:90443755-90443777 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1100051109 12:90448484-90448506 CTGGACTTCCTGGGTTGAGTCGG - Intergenic
1100209439 12:92386729-92386751 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1100210499 12:92393767-92393789 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1100519393 12:95358668-95358690 CTGAGCTGTTTGGGTTAAGTTGG + Intergenic
1100528782 12:95445450-95445472 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1100529271 12:95449137-95449159 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1100530640 12:95458289-95458311 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1100984186 12:100189246-100189268 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1101704530 12:107209719-107209741 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1101705552 12:107217303-107217325 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1104305835 12:127610383-127610405 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1104306905 12:127617714-127617736 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1104834202 12:131776842-131776864 GTGAGCTTTCTGGGTAAAGAGGG + Intronic
1105437202 13:20389505-20389527 CTGGACTTCCTGGGTAATGTGGG - Intergenic
1105476309 13:20730632-20730654 CTGGACTTCCTGGGTCTAGTGGG + Intronic
1105489812 13:20877108-20877130 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1105520957 13:21130474-21130496 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1105599836 13:21876850-21876872 GGGGACTTTCTGGGTCAAGTGGG - Intergenic
1105720359 13:23107675-23107697 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1105725404 13:23158780-23158802 CTGGACTTCCTGGGTGAAGTGGG + Intergenic
1106062876 13:26312034-26312056 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1106178464 13:27351204-27351226 CTGGACTTCCTGGGTCTAGTGGG - Intergenic
1106184859 13:27400392-27400414 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1106326710 13:28698269-28698291 CTGGACTTTCTGGGTCGGGTGGG + Intergenic
1106351724 13:28937120-28937142 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1106356731 13:28990372-28990394 CTGGACTTACTGGGTGTAGTGGG + Intronic
1106471053 13:30054515-30054537 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1106845805 13:33736639-33736661 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1107121098 13:36796611-36796633 CTGGGTTCTCAGGGTTAGGTAGG + Intergenic
1107170193 13:37332221-37332243 CTGGACTTCCTGGGTCAAGTAGG + Intergenic
1107343056 13:39430579-39430601 CTAGACTTCCTGGGTTGAGTGGG + Intronic
1107458655 13:40579248-40579270 CTGGGCTTTCTGAGCTACCTAGG - Intronic
1107790914 13:44001421-44001443 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1108118928 13:47161796-47161818 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
1108149760 13:47521325-47521347 TTGGACTTCCTGGGTCAAGTGGG - Intergenic
1108372381 13:49783231-49783253 CTTGGTTTTCTGGGTTAGGGAGG - Intronic
1108515681 13:51200539-51200561 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1108555342 13:51585293-51585315 CTGGGTTATCTGGATTCAGTAGG - Intronic
1108725400 13:53175289-53175311 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1108848277 13:54700388-54700410 CTGGACTACCTGGGTTGAGTGGG + Intergenic
1108849235 13:54707190-54707212 CTGGACTTCCTGGTTCAAGTGGG + Intergenic
1108867742 13:54942103-54942125 CTGGGCTTCCTGGGTCGAATAGG - Intergenic
1109272364 13:60268682-60268704 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
1109419782 13:62096360-62096382 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1109423981 13:62148974-62148996 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1109425172 13:62157784-62157806 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1109523702 13:63546095-63546117 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
1109527279 13:63593147-63593169 CTGTACTTCCTGGGTTGAGTGGG + Intergenic
1109735524 13:66479544-66479566 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1110525249 13:76528713-76528735 CTGACCTTTCTGTGTTAAATGGG + Intergenic
1110906430 13:80896475-80896497 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1111094022 13:83486643-83486665 CTGGGCTTCCTGGGTCGAGTGGG + Intergenic
1111250496 13:85595062-85595084 CTGGACTTCCTGGGATGAGTGGG + Intergenic
1111337975 13:86846955-86846977 CTGGACTTCCTGGGTCAGGTGGG + Intergenic
1111372219 13:87333637-87333659 CTGGACTTGCTGGGTCGAGTGGG + Intergenic
1111532063 13:89550586-89550608 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1111729284 13:92052712-92052734 CTGGACTTCCTGGCTCAAGTGGG - Intronic
1111805079 13:93030859-93030881 CTGGGCTTCCTGGGTTGAGTAGG + Intergenic
1111929460 13:94498701-94498723 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1113338477 13:109399588-109399610 CTGGACTTCCTGGGTCGAGTAGG - Intergenic
1113479957 13:110613537-110613559 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1113916090 13:113874953-113874975 CTAGGCTTCCTGGGTAAAGCGGG - Intergenic
1114575337 14:23707677-23707699 CTGGACTTCCTGGGTCAAGCGGG - Intergenic
1115060718 14:29186556-29186578 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1115727496 14:36233129-36233151 TTGGCCTTTCTGGGTCAAGTTGG + Intergenic
1116078731 14:40145757-40145779 CTGGGCTTTGGGAGGTAAGTAGG + Intergenic
1116142513 14:41016628-41016650 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
1116156138 14:41208712-41208734 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1116305251 14:43245744-43245766 GTGGACTTCCTGGGTTGAGTGGG + Intergenic
1116329795 14:43581120-43581142 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1116698219 14:48202792-48202814 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1117031348 14:51674188-51674210 GTGGGCTTTCTAGGAAAAGTTGG - Intronic
1118089840 14:62461758-62461780 CTGTGCTATCTGGGTAAACTTGG + Intergenic
1118379033 14:65202791-65202813 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1118532180 14:66718773-66718795 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1120335455 14:83148892-83148914 CTGGACTTCCTGGGTGGAGTGGG - Intergenic
1120352937 14:83386517-83386539 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
1120387623 14:83866067-83866089 CTGGACTTCCTGGGTCGAGTAGG + Intergenic
1120880641 14:89413195-89413217 CTGTTCTTTCTGTGTTACGTTGG - Intronic
1121072197 14:91034389-91034411 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1121154303 14:91668192-91668214 CTGGACTTCCTGGGTCGAGTAGG + Intronic
1121245894 14:92460635-92460657 CTGGGCTTTGTGGATCAGGTAGG + Intronic
1121668019 14:95686945-95686967 CTGGGCTTTGTGGGATGAGTAGG + Intronic
1122476770 14:102015529-102015551 CTGGGCTTCCTTGTTTAAGCTGG - Intronic
1123814455 15:23962458-23962480 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1123896148 15:24832389-24832411 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1124049808 15:26186574-26186596 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1124247339 15:28082061-28082083 CTGGACTTCCTGGGTGGAGTGGG + Intronic
1124360267 15:29031850-29031872 CTGAACTTCCTGGGTTGAGTGGG - Intronic
1124385844 15:29207707-29207729 CTGGACTTCCTGGGTGGAGTGGG - Intronic
1124441029 15:29686425-29686447 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1124655993 15:31507864-31507886 CTGGACTTCCTGGGTTGAGTGGG - Intronic
1124920259 15:34019148-34019170 CTGGACTTACTGGGTTGAGTGGG - Intronic
1125345654 15:38716081-38716103 CTGGATTTCCTGGGTTGAGTGGG + Intergenic
1126188193 15:45851211-45851233 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1126734841 15:51720641-51720663 CTGGACTTCCTGGGTCGAGTGGG + Exonic
1127093231 15:55487108-55487130 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1128983199 15:72200919-72200941 ATGGGCTGTGTGGGGTAAGTGGG - Intronic
1128988303 15:72237207-72237229 CTGTCCTTCCTGGGATAAGTGGG - Intergenic
1130656721 15:85796412-85796434 CTGGACTTTCTGGGTCCAGTGGG + Intergenic
1130890300 15:88127828-88127850 CTGGCCTTGCTGGGTAAAGGTGG - Intronic
1131007967 15:88993967-88993989 CTGGACTTCCTGAGTCAAGTGGG + Intergenic
1131136172 15:89937715-89937737 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1131410844 15:92207170-92207192 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1131411911 15:92214386-92214408 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1131478715 15:92763754-92763776 CTGGAGTTGCTGGGTTCAGTAGG - Intronic
1131514528 15:93068171-93068193 CTGGGCAAACTGGGATAAGTTGG + Intronic
1131593805 15:93775993-93776015 CCGGATTTTCTGGGTGAAGTGGG + Intergenic
1131719197 15:95148714-95148736 CTGGACTTCCTGGGTGGAGTGGG - Intergenic
1131738329 15:95358753-95358775 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1131782265 15:95872329-95872351 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1131949265 15:97663087-97663109 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1133419294 16:5632046-5632068 CTTGGCTTCCTAGCTTAAGTAGG - Intergenic
1133440352 16:5815998-5816020 TTGGGATTTCTGGGTTGAGAGGG + Intergenic
1134672719 16:16067727-16067749 CAGGGCTATTTGGGTAAAGTGGG + Intronic
1138168063 16:54821131-54821153 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1138493903 16:57395428-57395450 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1138953998 16:61949230-61949252 CTGGACTTCCTGGGTGGAGTGGG + Intronic
1139141176 16:64264407-64264429 CTGGACTTCCTAGGTTGAGTGGG - Intergenic
1139676003 16:68524072-68524094 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1139790402 16:69429527-69429549 CTGGACTTCCTGGGTGGAGTGGG - Intronic
1140000550 16:71020864-71020886 CTGTGTTGTCTGGGTTATGTAGG - Intronic
1140185921 16:72771946-72771968 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1141254382 16:82386962-82386984 CTTGTGTTTCTGGGTCAAGTTGG + Intergenic
1141342242 16:83213760-83213782 CTGGACTTCCTGGGTGGAGTGGG + Intronic
1141547454 16:84780611-84780633 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1141660551 16:85439026-85439048 CTGGGCTTTGTGGGTGATCTTGG - Intergenic
1142929119 17:3267278-3267300 CTGGACTTCCTGGGTAGAGTGGG + Intergenic
1143141368 17:4743616-4743638 ATGGGGTTTCTGGGTGGAGTTGG - Intronic
1144017428 17:11209360-11209382 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1144481325 17:15631799-15631821 CTGGGCTTCCTGGGGAAAGAAGG + Intronic
1144767122 17:17738908-17738930 CTGGGCTGTCTGGGTAAGGCTGG - Intronic
1144916980 17:18731932-18731954 CTGGGCTTCCTGGGGAAAGAAGG - Intronic
1145803785 17:27711928-27711950 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1145805023 17:27720480-27720502 CTAGACTTTCTGGGTCCAGTGGG + Intergenic
1145822175 17:27847262-27847284 CTGGGCTTCCTGGGTGGAGGGGG - Intronic
1146295086 17:31643154-31643176 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1146311434 17:31771351-31771373 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1146743500 17:35306713-35306735 CTGGGCTTCCTGGGTTGAGTAGG + Intergenic
1147969748 17:44212906-44212928 CTTGGCATTCTGGATTAGGTCGG + Exonic
1148018343 17:44538216-44538238 CTGGACTTTCTGGGTGGAGTGGG - Intergenic
1148189920 17:45671414-45671436 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1148502598 17:48103015-48103037 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1149074647 17:52580758-52580780 TTGGACTTCCTGGGTTGAGTGGG + Intergenic
1149077845 17:52617580-52617602 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1149213951 17:54332417-54332439 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1149922782 17:60675039-60675061 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1149964908 17:61152466-61152488 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1150135990 17:62695389-62695411 CTGGACTTCCTAGGTTGAGTGGG + Intergenic
1150161176 17:62899399-62899421 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1150178303 17:63086701-63086723 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1150646622 17:66982585-66982607 CTGGACTTCCTGGGTTGAGTGGG - Intronic
1151463098 17:74267036-74267058 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1152148690 17:78585242-78585264 CTGGGCTCTCAGGGCTGAGTAGG - Intergenic
1152260874 17:79266400-79266422 CTGTGCTTTCTGTGTTCTGTTGG + Intronic
1153174184 18:2351968-2351990 CTGGGCTTCCTGGGTTGATTAGG - Intergenic
1153300450 18:3587376-3587398 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1153906709 18:9668190-9668212 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1153967102 18:10191965-10191987 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1154080158 18:11248305-11248327 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1155573998 18:27225349-27225371 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1157045231 18:44094787-44094809 CTGGGCTTCCTGGGTCGAGTAGG + Intergenic
1157066569 18:44357101-44357123 CTTAGCTTGCTGGGTTATGTTGG + Intergenic
1158482262 18:57832258-57832280 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1159161588 18:64648766-64648788 CTGGACTTCCTGGGTCCAGTAGG - Intergenic
1159227986 18:65565283-65565305 CTGGACTTCCTGGATTGAGTGGG - Intergenic
1159729018 18:72001753-72001775 CCGGGCTTATTGGGTGAAGTGGG + Intergenic
1160080656 18:75724180-75724202 ATGGGATTTCTGGGTTAAATTGG + Intergenic
1161539022 19:4838477-4838499 TTGGGATTTCTGGTCTAAGTGGG - Exonic
1161597590 19:5158826-5158848 CTGGACTTCCTGGGTTGAGTGGG - Intronic
1161897330 19:7092331-7092353 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1162184948 19:8897599-8897621 CAGGGCTTTGAGGGTTAAGGTGG + Exonic
1162236582 19:9314466-9314488 CTGGACTTCCTGAGTTGAGTGGG - Intergenic
1164029508 19:21389658-21389680 CTGGACTTCCTGGGTCAAATGGG + Intergenic
1164779360 19:30880251-30880273 CTGGATTCTCTGGGTCAAGTAGG + Intergenic
1164978818 19:32596792-32596814 CTGTGCCTACTGGGTTAAGTAGG + Intergenic
1164992404 19:32693817-32693839 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1164993336 19:32700484-32700506 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1165006523 19:32812046-32812068 CTGGGCTTCGTGGGGTAACTAGG + Intronic
1165231152 19:34387808-34387830 CTGGGCTTGTTAGGTGAAGTGGG + Intronic
1165884551 19:39068643-39068665 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1167659083 19:50785534-50785556 CTGGGTTTTCAGGGATGAGTAGG - Intergenic
1168092398 19:54094891-54094913 CTGGACTTCCTGGGTTGAATGGG - Exonic
925421844 2:3719005-3719027 CTGGACTTCCTGGGTCGAGTGGG - Intronic
925952679 2:8929787-8929809 CTGGGCTTCCTGGGTCAAGTAGG + Intronic
928106730 2:28475379-28475401 CTGGACTTCCGGGGTTGAGTGGG - Intronic
928700155 2:33890768-33890790 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
929254219 2:39791941-39791963 CTGGACTTCCTGGGTGGAGTGGG - Intergenic
929330802 2:40677842-40677864 TTGGACTTCCTGGGTTGAGTGGG + Intergenic
929804398 2:45132134-45132156 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
931583408 2:63801770-63801792 CTGGACTTTCTGGGTAGGGTGGG - Intronic
931768399 2:65477080-65477102 ATGGACTTCCTGGGTCAAGTGGG - Intergenic
932960803 2:76410090-76410112 CTGGACTTTCTGGGTCGAGTGGG - Intergenic
932997054 2:76867995-76868017 TAGGGCTTTCTTGGTTAACTTGG - Intronic
933342512 2:81040270-81040292 GTGGGGCTTCTGGGTCAAGTGGG + Intergenic
933358998 2:81253332-81253354 ATGGGATTTCTAGGTCAAGTGGG + Intergenic
933611299 2:84438701-84438723 CTGGACTTCCTGGGTTGAGTGGG + Intronic
933623348 2:84570256-84570278 CTGGACTTCCTGGGTTGAGTGGG + Intronic
933730908 2:85455762-85455784 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
934020570 2:87947386-87947408 CTGGACTTCCTGGGTCAAGTAGG + Intergenic
934217393 2:90045824-90045846 CTGGACTTCCTGGGTGGAGTGGG - Intergenic
934679776 2:96275146-96275168 CTGCTCTTTCTAGGTGAAGTTGG - Exonic
934866765 2:97821109-97821131 CTGGACTTCCTGGGTTGAGTGGG + Intronic
935361423 2:102249943-102249965 CTGGGCATTCTGGGTTGAGGGGG + Intergenic
935482984 2:103616524-103616546 CTGGACTTCCTTGGTTGAGTGGG + Intergenic
935761022 2:106320825-106320847 CTGGACTTCTTGGGTCAAGTGGG - Intergenic
935789443 2:106577551-106577573 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
935897578 2:107754154-107754176 CTGGACTTTCTGGTTCGAGTGGG - Intergenic
936090133 2:109496440-109496462 CTGGACTTCCTGGGTCGAGTGGG - Intronic
936230319 2:110694859-110694881 CTGATCTTTCTTGGTTATGTAGG - Intergenic
936384558 2:112017381-112017403 CTGGACTTTCTGGGTTGAGTGGG - Intronic
936802074 2:116282431-116282453 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
936803011 2:116289155-116289177 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
936922668 2:117705226-117705248 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
937050459 2:118884135-118884157 CTGGACTTCCTGGGTCTAGTGGG - Intergenic
937337013 2:121068347-121068369 CCGGGCTTTCTTGGTGATGTTGG - Intergenic
937466385 2:122136493-122136515 CTGGGGTTTATTGGTGAAGTGGG + Intergenic
937706590 2:124927763-124927785 CTGGACTTCGTGGGTCAAGTGGG + Intergenic
938056116 2:128215939-128215961 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
938129345 2:128697907-128697929 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
938163364 2:129005953-129005975 CTGGACTTCCTGGGTTGACTGGG + Intergenic
938196049 2:129329379-129329401 TTGGACTTCCTGGGTTGAGTGGG + Intergenic
938224777 2:129606374-129606396 CTGGGCTTTGAGGGAAAAGTAGG - Intergenic
939085304 2:137711126-137711148 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
939292482 2:140214050-140214072 CTGCGCTTTCTGGCATCAGTGGG - Intergenic
939848724 2:147278906-147278928 CTGGCCTTTCAAGGTGAAGTGGG - Intergenic
939851490 2:147311325-147311347 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
939852574 2:147318726-147318748 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
939912050 2:147994936-147994958 CTGGACTTCCTGGGTCGAGTGGG + Intronic
940343384 2:152604200-152604222 ATGGGCATTCTGGGCTATGTGGG + Intronic
941144741 2:161830606-161830628 CATAGCTTTCTGGGTAAAGTAGG - Intronic
942111920 2:172691029-172691051 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
942172507 2:173301846-173301868 CTGGACTTTCTGGGATGAGTGGG - Intergenic
942425600 2:175857369-175857391 CTGGACTTCCTAGGTTGAGTGGG + Intergenic
943577697 2:189650692-189650714 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
943608573 2:190005462-190005484 CTGGACTTCCTGGGTCCAGTGGG - Intronic
944053077 2:195493442-195493464 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
944857270 2:203780011-203780033 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
946460478 2:219864242-219864264 CTGGGTTTTCTGGCTTTGGTTGG - Intergenic
946939238 2:224753883-224753905 ATGGACTTCCTGGGTTGAGTGGG - Intergenic
947190765 2:227502403-227502425 CTCCGCCTTCTGGGTTCAGTTGG + Intronic
1168875790 20:1171406-1171428 CTCGGCCTTCTGAGTTTAGTAGG + Intronic
1168948176 20:1778539-1778561 CTGGGCTTGCAGGGTGACGTTGG + Intergenic
1169460420 20:5789916-5789938 CTGGGCTTTCCTGGTCATGTTGG - Intronic
1169647991 20:7834818-7834840 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1169853587 20:10079210-10079232 CTGGACTTCCCGGGTCAAGTGGG - Intergenic
1172062772 20:32197649-32197671 GTGGGGTTTCTGGGCTGAGTGGG + Exonic
1172340264 20:34152076-34152098 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1173242720 20:41312075-41312097 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1175260908 20:57673548-57673570 CTGGGCTTTGAGGGTTAAAGAGG - Intronic
1175658240 20:60790582-60790604 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
1177136078 21:17306486-17306508 CTGAACTTCCTGGGTCAAGTGGG + Intergenic
1177200080 21:17944300-17944322 CTTGCCTTTCTGGGTTAGGCTGG - Intronic
1177288816 21:19083999-19084021 CTGGGCTAGCTGGGTTCAGTTGG + Intergenic
1177522632 21:22248050-22248072 CTGGGCTTTTTGGGTAACGATGG - Intergenic
1177967950 21:27751818-27751840 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1179023550 21:37660238-37660260 ATGGCCTTTCTTGGTCAAGTTGG - Intronic
1179427699 21:41294976-41294998 CTGGGCTATCTTGGTAAGGTGGG - Intergenic
1179612061 21:42558891-42558913 CCGGGCAGTCTGGGTGAAGTGGG - Intronic
1181897827 22:26126369-26126391 CTGGCCTTCCTGGGTGATGTGGG - Intergenic
1182553188 22:31112934-31112956 CTGGACTTCCTGGGTGGAGTGGG - Intronic
1182592648 22:31393885-31393907 CTGGACTTCCTTGGTTGAGTGGG + Intergenic
1182642948 22:31783013-31783035 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1182861814 22:33566895-33566917 CTGGACTTCCTGGGTCAAATGGG - Intronic
1183395639 22:37569296-37569318 CTGACCTTTCTGGGGTAAGAGGG - Exonic
1185313283 22:50168419-50168441 CTGGGTTATCTGGGTTGAATAGG + Intergenic
949547378 3:5083517-5083539 CTTGGCATTCTTGATTAAGTTGG + Intergenic
949643491 3:6066756-6066778 CTGGGCTTCCTGGGTCGAGTAGG + Intergenic
949671878 3:6406977-6406999 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
950083180 3:10238354-10238376 ATGGGTTTTCTGGGTGTAGTGGG + Intronic
950116705 3:10455450-10455472 CTGGGCTTCCTCTGTAAAGTGGG + Intronic
950204027 3:11064225-11064247 CTGGACTTGCTGGGTCCAGTGGG - Intergenic
950238824 3:11349248-11349270 CTGGACTTCCTGGGTTGAGTGGG - Intronic
950286958 3:11752571-11752593 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
950306441 3:11918182-11918204 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
950565370 3:13766823-13766845 CTGGGCTTTGAGGGGTAAGTAGG - Intergenic
951021122 3:17781668-17781690 CTGGACTTCCTGGGTCGAGTGGG + Intronic
951301868 3:21008323-21008345 CTGGACTTCCTGTGTTAACTGGG - Intergenic
951519116 3:23594785-23594807 CTGGGCATTCTGGAATAATTGGG - Intergenic
952554714 3:34519382-34519404 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
952555414 3:34524563-34524585 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
952631180 3:35469316-35469338 CTGGACTTGCTGGGTTGAGTGGG - Intergenic
953622348 3:44544015-44544037 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
953623307 3:44550927-44550949 CTGGAATTCCTGGGTCAAGTGGG - Intergenic
954231504 3:49221472-49221494 CTGGACTTCCTGGGTCGAGTGGG - Intronic
954232631 3:49229218-49229240 CTGGACTTCCTGGGTCTAGTGGG - Intronic
955090893 3:55749440-55749462 CTGGACTTCCTGGGTTGAGTGGG + Intronic
956600623 3:71018036-71018058 CTGTGCTTCCTGGGTTAAGCTGG + Intronic
956627171 3:71278127-71278149 CTGGTTTCTCTGGGTTACGTAGG - Intronic
957445857 3:80312050-80312072 CTGGGCTTCCTGGGTTGAGTAGG + Intergenic
957916894 3:86696985-86697007 CCTGGCTTCCTGGGTTGAGTAGG - Intergenic
958796235 3:98709282-98709304 CTTGGCTTCCTGGGTCAAGTAGG - Intergenic
959223729 3:103554951-103554973 CGGGGCTTCCTGGGTCGAGTAGG - Intergenic
959306843 3:104678053-104678075 CTGGACTTACTGGGTGGAGTGGG + Intergenic
959334386 3:105045797-105045819 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
959437369 3:106333116-106333138 CTGGGCTTTCTGGGAAAAGAAGG + Intergenic
959564273 3:107818410-107818432 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
959609284 3:108276250-108276272 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
959981093 3:112518696-112518718 CAGGGCTGTCAGGGATAAGTAGG - Intergenic
960063292 3:113346036-113346058 CTGGACTTCCTGGGTTGAGTGGG + Intronic
960064096 3:113352086-113352108 CTGGACTTCCTGGGTCAAGTGGG + Intronic
960352083 3:116606293-116606315 CTGGACTCTCTGGGTCAAGTGGG + Intronic
961018664 3:123486118-123486140 CAGGGGCTTCTGGGTTAATTTGG - Intergenic
961261304 3:125604341-125604363 CTGGGCTTCCTGGGTTGAGTGGG + Intergenic
961746858 3:129069308-129069330 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
962680243 3:137791893-137791915 CTGGGCCCTTTTGGTTAAGTGGG - Intergenic
963103799 3:141628344-141628366 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
963409574 3:144910035-144910057 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
963492376 3:146017615-146017637 GTGGGCTTCCTGGGTCTAGTAGG + Intergenic
963697339 3:148577610-148577632 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
964083728 3:152790604-152790626 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
964222897 3:154367120-154367142 CTGAGCTTCCTGGGTCAAGTAGG + Intronic
964223635 3:154372159-154372181 CTGGGCTTCCTGGGTCAAGTAGG + Intronic
964858195 3:161170428-161170450 ATGGGATTGCTGGGTCAAGTTGG + Intronic
964866199 3:161264592-161264614 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
964917391 3:161854000-161854022 TTGGGCTTCCTGGGCCAAGTAGG - Intergenic
965178610 3:165369375-165369397 GTGACCTTTCTGGATTAAGTCGG + Intergenic
966039279 3:175461431-175461453 CTGGAATTCCTGGGTCAAGTGGG - Intronic
967576938 3:191105451-191105473 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
967622364 3:191649434-191649456 CTGGGATTCCTGGGTCGAGTAGG + Intergenic
967734605 3:192939150-192939172 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
968212835 3:196863409-196863431 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
968384401 4:123559-123581 CTGGACTTCCTGGGTAAACTGGG - Intergenic
970296986 4:14641016-14641038 CTGGGTTTTCTGTGTTCATTGGG - Intergenic
970699988 4:18724926-18724948 CTGGATTTCCTGGGTTGAGTGGG + Intergenic
970720519 4:18983088-18983110 CTGGACTTCCTGGATTGAGTGGG - Intergenic
971533736 4:27721781-27721803 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
971578130 4:28302973-28302995 CTGAACTTCCTGGGTCAAGTGGG + Intergenic
971579037 4:28309859-28309881 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
971980070 4:33740700-33740722 CTAGGCTTCCTGGGTAGAGTAGG + Intergenic
972049779 4:34715135-34715157 TTGGGCTTCCTGGGTCGAGTAGG + Intergenic
972132817 4:35859421-35859443 CTGGACTTCCTGGGTTCAGTGGG - Intergenic
972133646 4:35864971-35864993 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
972213103 4:36862332-36862354 ATGGCCTTTCTGGGTTACTTTGG - Intergenic
972651452 4:41021365-41021387 CTGGACTTCCTGGGTCGAGTGGG + Intronic
972880758 4:43418901-43418923 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
972889301 4:43536554-43536576 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
973889280 4:55353188-55353210 CTGGACTTCCTGGGTGGAGTGGG + Intronic
974009568 4:56594549-56594571 CTCTCCTTTCTGGTTTAAGTAGG - Intronic
974127924 4:57718339-57718361 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
974395613 4:61330905-61330927 CTGGACTTCCTGGGTTGAGTAGG - Intronic
974509785 4:62823676-62823698 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
974520279 4:62973720-62973742 CTGGGCTTCCTGGGTCGAGTAGG + Intergenic
974969347 4:68804991-68805013 CTGGGCTTCCTGGGTCGAGTAGG + Intergenic
974994678 4:69140112-69140134 CTGGGCTTCCTTGGTCTAGTAGG + Intronic
975001275 4:69225329-69225351 CTCGGTTTCCTGGGTCAAGTAGG - Intergenic
975004165 4:69266956-69266978 CTGGGTTTCCTGGGTCGAGTAGG + Intergenic
975004908 4:69271978-69272000 CTGGGCTTCCTGGGTTGAGTAGG + Intergenic
975013332 4:69380958-69380980 CTGGGCTTTCTGGGTTAAGTAGG + Intronic
975019260 4:69467151-69467173 CTGGACTTCCTGGGTTGAGTAGG - Intergenic
976174002 4:82334287-82334309 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
976174716 4:82339264-82339286 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
976727472 4:88228657-88228679 CTGGACTTCCTGGGTCAAGTGGG + Intronic
977458681 4:97297398-97297420 CTGTCCCTTCAGGGTTAAGTAGG + Intronic
977479104 4:97551228-97551250 CTGGGCTTCCTGGGTCAGGTGGG - Intronic
979420087 4:120493599-120493621 CTGGACTTCCTGGGTTGAGTAGG + Intergenic
979687231 4:123524397-123524419 CTGGGGTTACTGGGTTCAGATGG - Intergenic
980001731 4:127497492-127497514 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
980186029 4:129462359-129462381 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
980291261 4:130849313-130849335 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
980392309 4:132162670-132162692 CTATGCTTCCTGGGTCAAGTAGG + Intergenic
980571283 4:134623328-134623350 CTGGGCTTCCTGGGTGGAGTAGG - Intergenic
981062956 4:140446297-140446319 CTGGGCTTTTTTGGTTCAGTAGG + Intronic
981159732 4:141483676-141483698 CTGGACTTCTTGGGTTGAGTGGG + Intergenic
981871928 4:149497198-149497220 CTGGGCTTTCTGGGAGGAGGAGG + Intergenic
982486201 4:155968573-155968595 CTGGACTTCCTGGGTTGAGTAGG - Intergenic
982773020 4:159415313-159415335 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
983033750 4:162836673-162836695 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
984290560 4:177788917-177788939 CTGGGCTTCCTGGGTCAAGTAGG + Intronic
984323842 4:178226905-178226927 CTAGGCTTCCTGGGTCCAGTAGG - Intergenic
984773988 4:183464527-183464549 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
985553531 5:544957-544979 CTGGACTTCCTGGGTTGAGTAGG + Intergenic
985559689 5:577638-577660 CTGGACTTCCTGGGTCGAGTAGG - Intergenic
985664170 5:1173366-1173388 CTGGACTTCCTGGGTCTAGTGGG - Intergenic
986360530 5:6974076-6974098 CTGGACTTTCTGGGGTGACTGGG + Intergenic
986871130 5:12048160-12048182 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
986929154 5:12796190-12796212 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
987107214 5:14651950-14651972 CTGAGCTTTCTGGGCAGAGTTGG + Intergenic
987361630 5:17112355-17112377 CTGGACTTCCTGGGTCGAGTGGG + Intronic
987673509 5:21045075-21045097 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
987818751 5:22934885-22934907 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
987929528 5:24387059-24387081 CTGGACTTCCTGGGTCGAGTAGG + Intergenic
987987193 5:25162559-25162581 CTGGGCTTCCTGGGTCGAGTAGG + Intergenic
988039960 5:25876333-25876355 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
988357474 5:30197755-30197777 CTGGACATCCTGGGTCAAGTGGG + Intergenic
988358374 5:30204678-30204700 CCGGACTTCCTGGGTTGAGTGGG + Intergenic
989069493 5:37496029-37496051 CTGGACTTTCTGGGTCGGGTGGG + Intronic
989243846 5:39231219-39231241 CTGGGATTTCTGTGTTACCTTGG + Intronic
989281829 5:39653289-39653311 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
989591023 5:43113122-43113144 CTGGACTTCTTGGGTTGAGTGGG - Intronic
989609417 5:43277087-43277109 CTGGGTTTTCTGGTCTAACTTGG - Exonic
989652072 5:43701602-43701624 GTGGGATTGCTGGGTCAAGTAGG + Intronic
989780075 5:45254201-45254223 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
990176324 5:53112354-53112376 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
990216738 5:53541182-53541204 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
990367332 5:55084662-55084684 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
991963728 5:72070790-72070812 CCTGGCTTTCTGGGTTTAGCAGG - Intergenic
991997754 5:72404829-72404851 CTGGACTTCCTGGGTTAAGTGGG + Intergenic
992545393 5:77809942-77809964 CTGGACTTCCTGGGTCAAGTGGG + Intronic
992572043 5:78068614-78068636 CTGGGCTTTTTGGGGTTGGTAGG - Intronic
993095654 5:83474731-83474753 CTCGGCTCTCTCGGTTAAGCTGG - Intronic
993926358 5:93871116-93871138 CTGAGCTTTCTTGTTAAAGTTGG + Intronic
994012443 5:94921488-94921510 ATGTGCTTTGTGGGTTAAGCAGG - Intronic
994344832 5:98672132-98672154 CTGGGCTTTTTGTGTTTGGTAGG - Intergenic
994489701 5:100425366-100425388 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
994756268 5:103797398-103797420 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
994908597 5:105872490-105872512 CTGGACTTCCTGGGTGGAGTAGG + Intergenic
995682809 5:114739434-114739456 CTGGGTTTTCTGCTTTTAGTTGG - Intergenic
996665767 5:126058461-126058483 CTGGACTTCCTGGGTCTAGTGGG + Intergenic
997150408 5:131487695-131487717 CTGGACTTCCTGGGTCAAGTAGG - Intronic
997426089 5:133803627-133803649 ATGGTCTTTCTGGGTGGAGTAGG + Intergenic
997788470 5:136735504-136735526 CTGGGCTTCCTGGGTCAAGTAGG + Intergenic
998712943 5:144847996-144848018 CTGGACTTCCTGGCTTGAGTAGG - Intergenic
999240964 5:150127154-150127176 CTGGGCCCTTTGGGTGAAGTGGG - Intronic
999269430 5:150288069-150288091 CTGGGCTCACAGGGTTATGTGGG - Intronic
999605934 5:153315885-153315907 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
999773352 5:154792057-154792079 TTGGGTTTTCTGAGTGAAGTAGG + Intronic
999794526 5:154976557-154976579 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1000518357 5:162268780-162268802 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1000535441 5:162472493-162472515 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1001497275 5:172198120-172198142 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1001697716 5:173684554-173684576 CTAGACTTTCTGGGTCGAGTGGG + Intergenic
1001806317 5:174589834-174589856 ACAGGCTTTCTTGGTTAAGTCGG - Intergenic
1001847147 5:174932398-174932420 CTGGGCTTTAAAGGGTAAGTAGG - Intergenic
1002085496 5:176772563-176772585 CTGGCCTTCCTGGGTCGAGTGGG + Intergenic
1002348234 5:178563016-178563038 CTGGACTTCCTGGGTGCAGTGGG - Intronic
1002577455 5:180182787-180182809 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1002615569 5:180453012-180453034 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1002617565 5:180465034-180465056 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1002828001 6:791259-791281 CTGGACTTCCTGGGTGGAGTGGG - Intergenic
1002854020 6:1021899-1021921 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1003249563 6:4414009-4414031 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1003271931 6:4614971-4614993 CTGGACTTCCTGGGTCAAGTCGG - Intergenic
1003329839 6:5120885-5120907 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1004508490 6:16265477-16265499 CTTGACTTTCTGGGTCCAGTGGG + Intronic
1004530991 6:16455746-16455768 CTGGACTTCCTGGGTTGAGTGGG + Intronic
1004532245 6:16464122-16464144 CTGGACTTCCTGGGTCAAGTAGG + Intronic
1004545379 6:16593178-16593200 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1005304167 6:24497588-24497610 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1006234464 6:32616445-32616467 CTGGGCTTCCTGGGTCGAGTAGG + Intergenic
1006759744 6:36449628-36449650 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1006901015 6:37501341-37501363 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
1007789856 6:44302761-44302783 CTGGGACTTCTGGGTTGAGTGGG - Intronic
1008257173 6:49317387-49317409 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1008886723 6:56439383-56439405 CTGGGGTTTTGGGGTTGAGTAGG - Intergenic
1009688015 6:66988291-66988313 CTAGACTTCCTGGGTCAAGTGGG - Intergenic
1009763751 6:68040895-68040917 CTGGACTTCCTGGGTTGAGTAGG - Intergenic
1009784694 6:68319815-68319837 TTGGGCTTTTTGGGTTGTGTGGG + Intergenic
1009870978 6:69451667-69451689 CTGGGCTTCCTGGGTTGACTAGG + Intergenic
1009907658 6:69889448-69889470 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1009946596 6:70347764-70347786 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1010437464 6:75850186-75850208 CTGGCCTTCCTGGGTCGAGTAGG - Intronic
1011225006 6:85095922-85095944 CTGGGCTTCCTGGGTCCAGTGGG + Intergenic
1012739752 6:103001148-103001170 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
1014201814 6:118617118-118617140 CTGGGCTTCCTGGGTCGAGTAGG + Intronic
1014203149 6:118626121-118626143 CTGAGCTTCCTGGGTTGAGTAGG + Intronic
1014404996 6:121040234-121040256 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1014691065 6:124564126-124564148 CTGGACTTCCTGGGTGGAGTGGG + Intronic
1015394576 6:132719958-132719980 CTGGGTTCTCTGGGTTATGTAGG - Intergenic
1016030277 6:139330014-139330036 ATTGAGTTTCTGGGTTAAGTAGG + Intergenic
1016348231 6:143139305-143139327 CTGGGACTTCTGGTTTAAGAGGG - Intronic
1017353235 6:153469514-153469536 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1017920446 6:158867997-158868019 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1018414575 6:163590209-163590231 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1018491797 6:164301686-164301708 CTGGACTTGCTGGGTTGAATGGG + Intergenic
1018815299 6:167325809-167325831 CTGGGCTTCCTGGGAGAGGTGGG + Intronic
1019463054 7:1171415-1171437 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1021060622 7:16106058-16106080 CTTGACTTTCTGGGTCAAGCTGG - Intronic
1021433656 7:20589551-20589573 CTAGACTTCCTGGGTCAAGTGGG - Intergenic
1021756149 7:23855150-23855172 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
1021757106 7:23862146-23862168 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1022457392 7:30570068-30570090 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1023258672 7:38336771-38336793 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
1024265546 7:47603526-47603548 CTGGATTTCCTGGGTTGAGTGGG + Intergenic
1024285274 7:47751681-47751703 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1024633054 7:51264966-51264988 CTGGGCATTCTGGGATGAGAAGG - Intronic
1024945493 7:54803750-54803772 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1026172763 7:67968808-67968830 CTGGACTTCCTGGGTTGAGTGGG + Intergenic
1026379636 7:69786086-69786108 CTGGACTTCCTGGGTTGAGTGGG + Intronic
1026541531 7:71283807-71283829 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1026549735 7:71357749-71357771 CTGGACTTACTGGGTTGAGTGGG + Intronic
1027570858 7:79865055-79865077 CTGGACTTTCTGGATTGAGTGGG - Intergenic
1027791937 7:82645347-82645369 TTGGACTTCCTGGGTCAAGTGGG + Intergenic
1028012943 7:85672288-85672310 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1029855168 7:103508046-103508068 CTGGGCTTTTTTTGTTTAGTAGG - Intronic
1030010847 7:105165394-105165416 CTGGACTTCCTGGGTCGAGTGGG + Intronic
1030657065 7:112180225-112180247 CGGGGGTTTCTGGGTTGAGGGGG - Intronic
1031250452 7:119373431-119373453 CTGGGCTTTTTGTGTTTGGTAGG - Intergenic
1032683089 7:134205333-134205355 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1032713950 7:134488079-134488101 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1032722855 7:134564854-134564876 CTGGACTTCCTGGGTCAAGTGGG + Intronic
1032786093 7:135200953-135200975 CTGGGATTTCTGTGTTATGAGGG - Intronic
1032927826 7:136629188-136629210 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1033857707 7:145585083-145585105 CTAGACTTCCTGGGTCAAGTGGG + Intergenic
1033979784 7:147149404-147149426 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1036155016 8:6333390-6333412 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1036592735 8:10183675-10183697 CTGGGCTTCCAGGGTAGAGTGGG - Intronic
1036920993 8:12855227-12855249 CTGGACATCCTGGGTCAAGTGGG - Intergenic
1037303331 8:17477604-17477626 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1037468610 8:19185424-19185446 CAGGGCTGTGTGTGTTAAGTGGG - Intergenic
1038336884 8:26652742-26652764 TTGGGCTTTGAAGGTTAAGTAGG + Intronic
1038524889 8:28264139-28264161 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1039129613 8:34248159-34248181 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1039275628 8:35932082-35932104 CTGGACTTTCTGGGTTGAGTGGG + Intergenic
1039276555 8:35938859-35938881 CTGGACTTCCTGGGTGAAGTGGG + Intergenic
1040103886 8:43528359-43528381 CTTGGCCTTCTGGGATAATTGGG + Intergenic
1040797217 8:51299540-51299562 CTGGACTTCCTAGGTTGAGTGGG - Intergenic
1041135189 8:54750513-54750535 CTGGACTTCCTAGGTCAAGTGGG + Intergenic
1041712725 8:60908930-60908952 CTGGGCTTTCTTTGTTTAGTTGG - Intergenic
1042771533 8:72387868-72387890 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1042772542 8:72394937-72394959 CTGGACTTCCTGGGTTGAATGGG + Intergenic
1042919228 8:73906041-73906063 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1042920349 8:73913604-73913626 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1043054885 8:75424913-75424935 ATGGGATTTCTAGGTCAAGTGGG + Intronic
1043057122 8:75453222-75453244 CTGGACTTCCTGGGTGGAGTGGG + Intronic
1044004618 8:86926172-86926194 CTGGACTTCCTGGGTCAAGTGGG - Intronic
1044067998 8:87722244-87722266 CTGGACTTCCTGGGTCAAATGGG - Intergenic
1044600495 8:93999067-93999089 CTGGACTTCCTGGGTAGAGTGGG + Intergenic
1044679125 8:94759413-94759435 CTGAACTTCCTGGGTTGAGTGGG - Intronic
1045198690 8:99956594-99956616 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1045858185 8:106788725-106788747 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1045858898 8:106793635-106793657 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1045861855 8:106822490-106822512 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1045928479 8:107598062-107598084 CTGGGCTTCCTGGGTTGAGTAGG - Intergenic
1045929712 8:107607091-107607113 CTGGGCTTCCCGGGTCGAGTAGG - Intergenic
1046143088 8:110120656-110120678 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1046337871 8:112813747-112813769 CTGGGCTTTCTGGGTCGAGTAGG - Intronic
1046373903 8:113350200-113350222 CTGGGCTGTCTGGGCTTAGCTGG - Intronic
1046469535 8:114652774-114652796 CTGGGCTTTCTGGGGCAGTTGGG + Intergenic
1046522089 8:115338195-115338217 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1048187271 8:132252823-132252845 CTGGTCTTCCTGGGTCGAGTGGG - Intronic
1048208702 8:132436875-132436897 CTGGGCTGCCTGGAGTAAGTGGG - Intronic
1048210473 8:132450463-132450485 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1048833712 8:138498595-138498617 CTGGGCTTGCTGGGTGCTGTGGG - Intergenic
1049832683 8:144712488-144712510 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1049989054 9:975694-975716 CTGGGGTCTATGGGTTAAGGAGG + Intergenic
1050528378 9:6565366-6565388 CTCTCCTTTCTGGTTTAAGTAGG + Exonic
1050872624 9:10592575-10592597 CTGGACTTACTGGGTTGAGTGGG + Intronic
1051680332 9:19600975-19600997 CTGGACTTCCTGGGTCTAGTGGG + Intronic
1051955458 9:22687623-22687645 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1052318207 9:27138538-27138560 CTGGACTTCCTGGGTCAAGTGGG - Intronic
1052432635 9:28387038-28387060 CTGGACTTCCTGGGTTGAGTGGG + Intronic
1052982664 9:34460151-34460173 CTGTGCTCAGTGGGTTAAGTGGG - Intronic
1053532761 9:38898378-38898400 CTGGACTTCCTGGGTTGCGTGGG - Intergenic
1053848284 9:42264256-42264278 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1054204987 9:62122807-62122829 CTGGACTTCCTGGGTTGCGTGGG - Intergenic
1054575875 9:66856422-66856444 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1054633372 9:67465563-67465585 CTGGACTTCCTGGGTTGCGTGGG + Intergenic
1055241813 9:74195451-74195473 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1055457841 9:76489704-76489726 CTGGACTTCCTGGGTCAAGTGGG - Intronic
1055748285 9:79474915-79474937 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1055990281 9:82098649-82098671 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1056239087 9:84625863-84625885 CTGGCTTTTCTGGGTCAATTAGG + Intergenic
1056608557 9:88108789-88108811 CAGGACTTCCTGGGTTGAGTGGG + Intergenic
1056846441 9:90041723-90041745 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1056884510 9:90428264-90428286 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1057001858 9:91517425-91517447 CTGGACTTCCTGGGTGGAGTGGG + Intergenic
1057310441 9:93939647-93939669 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1057341332 9:94204521-94204543 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1057343476 9:94225356-94225378 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1057395596 9:94677044-94677066 CTGGACTTACTGGGTCCAGTGGG - Intergenic
1057457896 9:95231031-95231053 CTGGACTTCCTAGGTCAAGTGGG - Intronic
1057496939 9:95568780-95568802 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1058379757 9:104364356-104364378 CTGGACTTCCTGGGTCATGTGGG - Intergenic
1058826893 9:108783198-108783220 CTGGGCTTCCTGGGTGAGCTGGG - Intergenic
1059211839 9:112520095-112520117 CTGGGCTTGATGGATTAAATTGG + Intronic
1060636198 9:125201228-125201250 CTGGGCTTTGAAGGTTAACTAGG + Intronic
1061100089 9:128485628-128485650 CTGGGCTTTCTGGTTGGAGCTGG + Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1061824075 9:133247071-133247093 CAGAGCTCTCTGGGTTGAGTGGG - Intergenic
1186024030 X:5288878-5288900 CTGGACTTCCTGGGTGGAGTGGG - Intergenic
1186325421 X:8471497-8471519 ATGGGATTTCTGGGTCAAATGGG + Intergenic
1187209536 X:17215451-17215473 CTGGGCTCTCTGTTTTGAGTAGG - Intergenic
1188617375 X:32175183-32175205 CTGGACTTTCTGGGTCGAGTGGG + Intronic
1188771146 X:34156149-34156171 CTGGGCTTTGTGGGGTTGGTAGG + Intergenic
1189810702 X:44778290-44778312 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1190541026 X:51479213-51479235 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1190951105 X:55143678-55143700 CTGGGCTTCCTGGGTCAAGTAGG - Intronic
1192484553 X:71513780-71513802 CTGGACTTCCTGGGTTGAGTGGG + Intronic
1192486416 X:71530901-71530923 CTGGACTTCCTGGGTTGGGTGGG - Intronic
1193036154 X:76953666-76953688 CTGGGCTTTCTTTGGTTAGTAGG - Intergenic
1193462342 X:81806399-81806421 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
1193463058 X:81812478-81812500 CTGGGCTTTCTGGGTCGAGTAGG - Intergenic
1193850892 X:86536282-86536304 CTGGGCTTCCTGGGTCGAGTAGG - Intronic
1193870876 X:86796392-86796414 CTGGACTTCCTGGGTTGAGTGGG - Intronic
1193888517 X:87013440-87013462 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1194056126 X:89134287-89134309 ATGGGATTTCTGGGTCAAATGGG + Intergenic
1194155613 X:90384223-90384245 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1195552774 X:106187022-106187044 CTGGACTTCCTGGGTCGAGTGGG - Intronic
1196312877 X:114189017-114189039 CTGGACTTCCTGGGTCTAGTGGG + Intergenic
1196378416 X:115061773-115061795 CTGGACTTCCTGGGTCTAGTGGG + Intergenic
1196419799 X:115509814-115509836 CTGGACTTCCTGGGTCAGGTGGG - Intergenic
1197398787 X:125962755-125962777 CTGGACGTCCTGGGTCAAGTGGG - Intergenic
1197575616 X:128207655-128207677 CTGGGCTTCCTGGGTCGAGTAGG + Intergenic
1197575858 X:128210619-128210641 CTGGGCTTCCTGGGTCAAGTAGG + Intergenic
1198465838 X:136904094-136904116 CTGGACTTCCTGGGTCGAGTAGG + Intergenic
1198977330 X:142351449-142351471 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1199123951 X:144091743-144091765 CTGGACTTCCTGGGTCAAATAGG - Intergenic
1199368190 X:147013548-147013570 ATGGGATTTCTGGGTTGAATGGG - Intergenic
1200364022 X:155642047-155642069 CTGGGCTTCCTGGGTCTAGCAGG - Intronic
1200392588 X:155958786-155958808 CTGGGCTTCCTGGGTCTAGCAGG - Intergenic
1200569082 Y:4805230-4805252 CTGGACTTCCTGGGTAGAGTGGG + Intergenic
1200710922 Y:6484317-6484339 CTGGACTTCCTGGATCAAGTGGG + Intergenic
1200775852 Y:7169784-7169806 CTGGGCTTCCTGAGTCAAGTGGG + Intergenic
1200776888 Y:7177282-7177304 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1200801375 Y:7390113-7390135 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1200888346 Y:8295860-8295882 CTGGACTTCCTGGATTGAGTGGG - Intergenic
1200966382 Y:9043010-9043032 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1201023012 Y:9677668-9677690 CTGGACTTCCTGGATCAAGTGGG - Intergenic
1201271633 Y:12261438-12261460 CTGGACTTTGTGGGTTGAGTGGG - Intergenic
1201272314 Y:12267008-12267030 CTAGACTTCCTGGGTTGAGTAGG - Intergenic
1201312417 Y:12608702-12608724 CTGGACTTCCTAGGTCAAGTGGG - Intergenic
1201396276 Y:13552558-13552580 CTGGACTTCCTGGGTCAAGAGGG + Intergenic
1201406735 Y:13657598-13657620 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1201407841 Y:13666200-13666222 CTGGACTTCCTGGGTCGAGTGGG - Intergenic
1201531335 Y:14992191-14992213 CTAGACTTCCTGGGTCAAGTGGG + Intergenic
1201639519 Y:16164512-16164534 CTGGGCTTCCTGGATTCAGTAGG - Intergenic
1201640659 Y:16173001-16173023 CTAGGTTTCCTGGGTTGAGTAGG - Intergenic
1201644071 Y:16208236-16208258 CTGGTCTTCCTGGGTAGAGTAGG - Intergenic
1201649272 Y:16266970-16266992 CTGGACTTCCTGGGTCTAGTGGG - Intergenic
1201653537 Y:16318330-16318352 CTGGACTTCCTGGGTCTAGTGGG + Intergenic
1201658744 Y:16377085-16377107 CTGGTCTTCCTGGGTAGAGTAGG + Intergenic
1201662156 Y:16412325-16412347 CTAGGTTTCCTGGGTTGAGTAGG + Intergenic
1201663294 Y:16420812-16420834 CTGGGCTTCCTGGATTCAGTAGG + Intergenic
1201676817 Y:16595218-16595240 CTGGACTTCCTGGGTCAAGTGGG + Intergenic
1201711052 Y:16992505-16992527 CTGGACTTTCTGGGTCGAGTGGG + Intergenic
1201743458 Y:17346988-17347010 CTGGGCTTCCTGGGTCGAGTAGG - Intergenic
1201750340 Y:17424453-17424475 CTGGGCTTCCTGGGTCAAGTAGG - Intergenic
1201918919 Y:19213137-19213159 ATGGGCTTCCTGGGTCAAGTGGG + Intergenic
1201931231 Y:19351677-19351699 CTGGACTTCCTGGGTCGAGTGGG + Intergenic
1201982150 Y:19919491-19919513 CTGGACTTCCTGGGTTGAGTAGG - Intergenic
1201989890 Y:20011769-20011791 CTGGACTTCCTGGGTTGAGTGGG - Intergenic
1202082400 Y:21097570-21097592 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1202089563 Y:21175757-21175779 CTGGACTTCCTGGGTCAAGTGGG - Intergenic
1202147056 Y:21809166-21809188 CTGAACTTCCTGGGTTGAGTGGG - Intergenic