ID: 975016396

View in Genome Browser
Species Human (GRCh38)
Location 4:69425941-69425963
Sequence CCTTAGCCTACATTTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975016392_975016396 16 Left 975016392 4:69425902-69425924 CCATTTATATATCTTCTTTTGAG 0: 64
1: 1496
2: 3736
3: 5608
4: 8989
Right 975016396 4:69425941-69425963 CCTTAGCCTACATTTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975016396 Original CRISPR CCTTAGCCTACATTTTGTTG GGG Intergenic
No off target data available for this crispr