ID: 975016746

View in Genome Browser
Species Human (GRCh38)
Location 4:69430872-69430894
Sequence CTCGCACGCCCGCACTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975016734_975016746 22 Left 975016734 4:69430827-69430849 CCGGGGGATGGGGGAGGAAGAGA No data
Right 975016746 4:69430872-69430894 CTCGCACGCCCGCACTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975016746 Original CRISPR CTCGCACGCCCGCACTGCCC AGG Intergenic
No off target data available for this crispr